Генотипы групп крови: ГЕНОТИПИРОВАНИЕ ГРУПП КРОВИ СИСТЕМ ABO И РЕЗУС У ПАЦИЕНТОВ ПОСЛЕ МНОЖЕСТВЕННЫХ ГЕМОТРАНСФУЗИЙ | Каландаров

Содержание

ГЕНОТИПИРОВАНИЕ ГРУПП КРОВИ СИСТЕМ ABO И РЕЗУС У ПАЦИЕНТОВ ПОСЛЕ МНОЖЕСТВЕННЫХ ГЕМОТРАНСФУЗИЙ | Каландаров

1. Донсков С.И., Гапонова Т.В. Иммунологическая безопасность переливания эритроцитов (развитие концепции). Вестник службы крови России 2013,2:1–9 [Donskov S.I., Gaponova T.V. Immunological safety of red blood cell transfusions (concept development). Vestnik sluzhby krovi Rossii = Bulletin of Russia Blood Service 2013,2:1–9 (In Russ.)].

2. Chiaroni J., Legrand D., Dettori I. et al. Analysis of ABO discrepancies occuring in 35 French hospitals. Transfusion 2004,44:860–3. DOI: 10.1111/j.1537-2995.2004.03337.x.

3. Migeot V., Ingrand I., Salmi R.L. et al. Reliability of bedside ABO testing before transfusion. Transfusion 2002,42:1348–55. PMID: 12423520.

4. Жибурт Е.Б., Шестаков Е.А., Караваев А.В. и др. Стратегия безопасности переливания крови. Гематология и трансфузиология 2012,57(3):10. [Zhiburt E.B., Shestakov E.A., Karavaev A.V. et al. Strategy of blood transfusion safety. Gematologiya i transfuziologiya = Hematology and Transfusiology 2012,57(3):10 (In Russ.)].

5. Shautsukova L.Z., Shogenov Z.S. The Rhesus blood group system: analytical review. Modern problems of science and education 2015, Issues 2 (Part 1).

6. Westhoff C.M. The Structure and Function of the Rh Antigen Complex. Seminars in Hematology 2007,44(1):42–50. DOI: 10.1053/j.seminhematol.2006.09.010.

7. Flegel W.A. How I manage donors and patients with a weak D phenotype. Current Opinion in Hematology 2006,13(6):476–83. DOI: 10.1097/01.moh.0000245694.70135.c3.

8. Garratty G. Do we need to be more concerned about weak D antigens? Transfusion 2005,45(Issue 10): 1547-1551. DOI: 10.1111/j.1537-2995.2005.00625.x.

9. Avent N.D., Finning K.M., Liu W. et al. Molecular biology of partial D phenotypes. Transfus Clin Biol 1996, 3(Issue 6):511–6. PMID: 9018818.

10. Wagner F.F., Eicher N.I., Jorgensen J.R. et al. DNB: a partial D with anti-D frequent in Central Europe. Blood 2002,100:2253–6. DOI: 10.1182/blood-2002-03-0742.

11. Silvy M., Simon S., Gouvitsos J. et al. Weak D and DEL alleles detected by routine SNaPshot genotyping: identification of four novel RHD alleles. Transfusion 2011,51(2):401–11. DOI: 10.1111/j.1537-2995.2010.02830.x.

12. Wagner T., Kormoczi G., Buchta C. et al. Anti-D immunization by DEL red blood cells. Transfusion 2005,45: 520–6. DOI: 10.1111/j.0041-1132.2005.04256.x.

13. Yasuda H., Ohto H., Sakuma S. et al. Secondary anti-D immunization by DEL red blood cells. Transfusion 2005,45(10):1581–4. DOI: 10.1111/j.1537-2995.2005.00579.x.

14. Wagner F.F., Gasner C., Müler T.H. et al. Molecular basis of weak D phenotypes. Blood 1999,93:385–93. PMID: 9864185.

15. Минеева Н.В. Особенности исследования антител к антигенам эритроцитов у доноров. Трансфузиология 2013,13(3): 14–20. [Mineeva N.V. Features of antibodies to erythrocyte antigens detection in donors. Transfuziologiya = Transfusiology 2013,13(3):14–20 (In Russ.)].

16. Nance S.T. Red cell antibody detection by serology. ISBT Science Series 2015,10(Suppl. 1):1–4. DOI: 10.1111/voxs.12128.

17. Meny G. Determining the clinical significance of alloantibodies. ISBT Science Series 2015,10(Suppl. 1):39–43. DOI: 10.1111/voxs.12124.

18. Бутина Е.В., Зайцева Г.А., Удальцова В.Ф. и др. Аллосенсибилизация к антигенам эритроцитов у доноров компонентов крови и пациентов с заболеваниями системы крови. Вестник службы крови 2012,3:18–21. [Butina E.V., Zaytseva G.A., Udaltsova V.F. et al. Allosensitization to erythrocyte antigens in blood donors and patients with blood diseases. Vestnik sluzhby krovi Rossii = Bulletin of Russia Blood Service 2012,3:18–21 (In Russ.)].

19. Минеева Н.В., Гавровская С.В., Кробинец И.И. и др. Частота выявления антиэритроцитарных, антилейкоцитарных, антитромбоцитарных аллоантител у больных гематологическими заболеваниями. Онкогематология 2013,4:13–7. [Mineeva N.V., Gavrovskaya S.V., Krobinets I.I. et al. Frequency of anti-erythrocyte, antileukocytic, antiplatelet alloantibodies in patients with hematological diseases. Onkogematologiya = Oncohematology 2013,4:13–7 (In Russ.)].

20. Минеева Н.В., Пашкова И.А. Специфичность антиэритроцитарных антител у больных многопрофильного стационара. Трансфузиология 2014,15(1):53–4. [Mineeva N.V., Pashkova I.A. Specificity of anti-erythrocyte antibodies in patients in multidisciplinary hospital. Transfuziologiya = Transfusiology 2014,15(1):53–4 (In Russ.)].

21. Донсков С.И., Мороков В.А. Группы крови человека: Руководство по иммуносерологии. М., 2011. 1016 с. [Donskov S.I., Morokov V.A. Human blood groups. Guide to immunoserology. Moscow, 2011. 1016 pp. (In Russ.)].

22. Salah K.H., Alaa H.A. Normal distribution of ABO blood groups and Rhesus factor in Al-Najaf province. European Journal of Experimental Biology 2015,5(7):18–21.

23. Prakash D.S., Varma P.J., Reddy S.G. et al. Genetic Variation of Blood Group Polymorphism among an Endogamous Human Population from Andhra Pradesh, India. International Journal of Scientific Study 2013,1(2):22–5. Avaiable at: http://www.ijss-sn.com/ uploads/2/0/1/5/20153321/original_ article_3.pdf.

24. Белопухов В.М., Тураев Р.Г., Бельская Е.Е. и др. Распределение групп крови среди доноров Республики Татарстан. Казанский медицинский журнал 2015,96(3): 437–40. [Belopukhov V.M., Turaev R.G., Belskaya E.E. et al. Distribution of Blood Groups among the Donors of the Republic of Tatarstan. Kazanskiy meditsinskiy zhurnal = Kazan Medical Journal 2015,96(3):437–40 (In Russ.)]. DOI: 10.17750/KMJ2015-437.

25. Flegel W.A., Wagner F.F., Muller T.H. et al. Rh phenotype prediction by DNA typing and its application to practice. Transfusion Medicine 1998,8:281–302. PMID: 9881423.

26. Flegel W.A. Molecular genetics of RH and its clinical application. Transfus Clin Biol 2006,13:4–12. DOI: 10.1016/j.tracli.2006.02.011.

27. Wenk R.E., Chiafari F.A. DNA typing of recipient blood after massive transfusion. Transfusion 1997,37:1108–10. PMID: 9426631.

28. Legler T.G., Eber S.W., Lakomek M. et al. Application of RHD and RHCE genotyping for correct blood group determination in chronically transfused patients. Transfusion 1999,39:852–5. PMID: 10504121.

29. Rozman P., Dovc T., Gassner C. Differentiation of autologous ABO, RHD, RHCE, KEL, Jk and FY blood group genotypes by analysis of peripheral blood samples of patients who have recently received multiple transfusions. Transfusion 2000,40:936–42. PMID: 10960520.

30. Reid M.E., Rios M., Powell V.I. et al. DNA from blood samples can be used to genotype patients who have recently received a transfusion. Transfusion 2000,40:48–53. PMID: 10644811.

31. Kroll H., Carl B., Santoso S. et al. Workshop Report on the Genotyping of Blood Cell Alloantigens. Transfusion Medicine 2001,11:211–9. PMID: 11422952.

32. Anstee D.J. Red cell genotyping and future of pretransfusion testing. Blood 2009,114(2):248–56. DOI: 10.1182/blood-2008-11-146860.

33. Reid M.E. Transfusion in the age of molecular diagnostics. Hematology 2009,1:171–7. DOI: 10.1182/ asheducation-2009.1.171.

34. Scharberg E.A., Richter E., Bugert P. Red cell antigen testing. ISBT Science Series 2015,10(1):5–11. DOI: 10.1111/voxs.12134.

35. Bakanay S.M., Ozturk A., Ileri T. et al. Blood group genotyping in multitransfused patients. Transfusion and Apheresis Science 2013,48:257–61. DOI: 10.1016/j.transci.2013.01.009.

36. Chou S.T., Jackson T., Vege S. et al. High prevalence of red cell alloimmunization in sickle cell disease despite transfusion from Rh-matched minority donors. Blood 2013,122(6):1062–71. DOI: 10.1182/blood-2013-03-490623.

37. Gooch A., Parker J., Wray J. et al. Guideline for blood grouping and antibody testing in pregnancy. Transfusion Medicine 2007,17:252–62. DOI: 10.1111/j.1365-3148.2007.00767.х.

38. Karafin M.S., Denomme G.A., Bryant B.J. The future of red blood cell alloimmunization risk reduction. Transfusion 2015,55: 220–1. DOI: 10.1111/trf.12863.

39. Kacker S., Ness P.M., Sue Shirey R. The future of red blood cell alloimmunization risk reduction. Transfusion 2015,55:222–3. DOI: 10.1111/trf.12866.

40. Curvers J., Scharnhorst V., de Haas M. et al. Blood group genotyping in a multitrauma patient: a case report. Immunohematology 2012,28(3):85–7. PMID: 23286553.

41. Rodrigues E.S. et al. Rapid blood group genotyping by allelic discriminative realtime PCR in multiply transfused patients. Transfusion Medicine 2015,1–4. DOI: 10.1111/tme.12186.

Резус-фактор, определение генотипа и статуса носительства

Резус-фактором называется антиген D системы группы крови Rhesus. Статус по этому антигену очень важен при переливании крови, беременности, пересадке органов. Белок, формирующий антиген D, кодируется геном RHD. Наличие этого гена даже на одной из двух гомологичных хромосом соответствует резус-положительному (Rh+) статусу. Примерно 85% населения Европы являются носителями этого гена и, соответственно, резус-положительны. При этом около половины всех жителей Европы и России несут одну копию этого гена, а 35% — две. При делеции гена

RHD в гомозиготной форме, т.е. его отсутствии на обеих гомологичных хромосомах, у человека резус-отрицательный (Rh-) статус.

При беременности резус-отрицательной женщины важно знать, какой резус-фактор у плода. Дело в том, что если в такой ситуации плод окажется Rh+, то существует вероятность развития резус-конфликта между матерью и плодом, который может привести к возникновению гемолитической болезни плода или новорожденного. Предсказать возможные варианты статуса плода по резус-фактору можно заранее, зная генотип родителей по гену RHD. Скрининговым методом определения резус-фактора является анализ крови на наличие антигена D на поверхности клеток, который позволяет оценить статус Rh+ или Rh-. Однако в случае, когда будущая мать резус-отрицательна, а отец – резус-положителен, для определения возможных вариантов (генотипов) резус-фактора у детей необходимо установить генотип отца по гену RHD. Так, если у отца ген RHD присутствует на обеих гомологичных хромосомах (т.е. отец – гомозигота), то все дети в такой супружеской паре будут резус-положительны. А если на одной из гомологичных хромосом ген RHD отсутствует (т.е. отец – гетерозигота), то в такой супружеской паре дети могут быть как резус-положительны, так и резус-отрицательны.

Также существуют мутации в гене RHD, которые приводят к особым статусам по резус-фактору: Weak D, DEL, Partial D. Такие варианты могут быть неверно или неоднозначно идентифицированы при обычном анализе крови на резус-фактор и могут быть выявлены с помощью генетического анализа гена RHD. Эти особые статусы встречаются очень редко, однако могут быть опасны из-за несоответствия полученного при обычном анализе крови результата реально существующему статусу резус-фактора.

В нашей лаборатории для генотипирования по резус-фактору используется современный метод MLPA, который позволяет выявить статус носительства 0, 1 или 2 копий гена RHD, а также идентифицировать особые мутантные формы этого гена с высокой надежностью и эффективностью.

Группы крови и особенности их наследования

Тема, касающаяся группы крови, встречается в ЕГЭ только в заданиях с развернутым ответом. Как правило, это задачи на наследование групп крови, наследования резус-фактора. Чтобы решать такие задания без каких-либо проблем, достаточно понять механизм наследования этих двух неотъемлемых составляющих организма человека, а также следовать рекомендациям нашего преподавателя Алисы Эдгаровны

 

 

Для начала определимся, что же такое группы крови и резус-фактор.

На клетках крови, которые в организме переносят кислород — эритроцитах — есть специальные белки. В мембране эритроцитов человека содержится около 300 таких белков. Их молекулярное строение закодировано определенными генами (именно про варианты этих генов и идет речь в некоторых задачах). Самыми важными классификациями групп крови человека являются система AB0 и резус-фактор.

Система «AB0»

В медицине (для целей переливания крови от одного человека другому) важно знать, как происходит взаимодействие между антигенами эритроцитов и антителами, находящимися в крови. В плазме крови человека могут содержаться антитела анти-А и анти-В, на поверхности эритроцитов — антигены A и B, причём из белков A и анти-А содержится один и только один, то же самое — для белков B и анти-В. Полное отсутствие антигенов на эритроцитах и присутствие обоих антител в плазме характеризуют первую группу крови. При переливании крови контролируется состав антиген-антитело. В случае содержания в крови (при переливании) одновременно эритроцитов с антигенами A и антител анти-A в плазме крови происходит склеивание эритроцитов, то же происходит при наличии антигенов B и антител анти-B.  

 

 

На этом основана реакция агглютинации (склеивания) при определении группы крови системы AB0, когда берётся кровь пациента и стандартные группоспецифические сыворотки.

В современном мире переливание крови производится по принципу ориентирования на группу крови реципиента (тот, кто принимает переливание), для недопущения развития осложнений.

Если в медицинском центре нет крови, которая бы идеально подходила реципиенту, переливают кровь по следующему принципу: 

Таким образом, в экстренных ситуациях человек с группой крови 1(0) является универсальным донором*, а человек с 4(АВ) — универсальным реципиентом*.

————————————————————————————————————————————

До́нор (от лат. dono — «дарю») — в общем смысле это объект, отдающий что-либо другому объекту (называемому «акце́птором» или «реципие́нтом»).

Реципие́нт (лат. recipere — получать, принимать) — объект или субъект, получающий (принимающий) что-либо от другого объекта или субъекта, называемого донором.

————————————————————————————————————————————

Система «резус-фактор»

Клинически наиболее важной системой группы крови после системы AB0 — это система резус-фактор. В зависимости от человека, на поверхности красных кровяных телец может присутствовать или отсутствовать «резус-фактор», то есть антиген D. Часто используемые термины «резус-фактор», «отрицательный резус-фактор» (Rh-) и «положительный резус-фактор» (Rh+) относятся только к отсутствию или наличию антигена D. Резус-положительными являются около 85% людей европеоидной расы. Кровь переливают строго по совпадению резус-фактора.

 

Наследование систем «AB0» и «резус-фактор»

Чаще всего школьники встречаются с данными понятиями в 28 задании (С6) — задачи по генетике. Наследование этих систем отличается друг от друга. Вспомним, что поколение F1 зависит от генотипа родителей, и один вариант гена потомок получает от отца, а второй — от матери.

Наследование системы AB0 связано с явлением кодоминирования — когда существует несколько доминантных аллелей одного гена. В случае системы AB0 — это  сразу два доминантных аллеля A и B. Исходя из этого, рассмотрим возможные генотипы родителей по группам крови:

Генотип человека с 1(0) группой обозначается  iº iº. При этом, аллель iº является рецессивным, а первая группа крови проявляется всегда только при двух рецессивных аллелях в одном организме. Гаметы у такого организма всегда будут iº.

Генотип человека с 2(А) группой обозначается IA iº (гетерозигота с рецессивным аллелем iº ) или IA IA (гомозигота по доминантному аллею A). Гаметы первого варианта — IA и iº, второго варианта — IA.

Генотип человека с 3(B) группой обозначается IB iº (гетерозигота с рецессивным аллелем iº) или IB IB (гомозигота по доминантному аллелю B). Гаметы первого варианта — IB и iº, второго варианта — IB.

Генотип человека с 4(AB) группой обозначается IA IB (оба доминантных аллеля проявляются в фенотипе). Гаметы — IA и IB.

Для наглядности и примера разные варианты наследования группы крови представлены в таблице. Она не отражает причину появления той или иной группы у потомства (в рамках статьи все случаи наследования рассмотреть невозможно), но дает упрощенное представление о данном процессе. 

 

 

Наследование резус-фактора происходит по обычной схеме полного доминирования.

R — наличие резус-фактора

r- отсутствие резус-фактора

Генотип человека с положительным резус-фактором (Rh+) может быть представлен двумя вариантами — RR (гомозигота по доминантному аллею R) или Rr (гетерозигота).

Генотип человека с отрицательным резус-фактором (Rh-) может иметь только один вариант — rr (гомозигота по рецессиву).

Родители резус-положительны (RR, Rr) — ребенок может быть резус-положительным (RR, Rr) или резус-отрицательным (rr).

Один родитель резус-положительный (RR, Rr), другой резус-отрицательный (rr) — ребенок может быть резус-положительным (Rr) или резус-отрицательным (rr).

Родители резус-отрицательны, ребенок может быть только резус-отрицательным.

© blog.tutoronline.ru, при полном или частичном копировании материала ссылка на первоисточник обязательна.

Группа крови и резус-фактор

Всем известно, что кровь бывает разных групп, но вот что это значит, знают немногие. Как было установлено в последнее время, группы крови — это признак, который достался нам от очень далеких предков. В какой-то степени она может определять характер человека, его наклонности и даже будущую профессию. Собственная группа крови — это то, что человек должен знать обязательно. 

Что такое группа крови (Blood group, AB0)?

Группа крови — это признак, который передается по наследству и не изменяется в течение жизни при естественных условиях. Принадлежность человека к той или иной группе крови является индивидуальной особенностью, которая начинает формироваться уже на ранних сроках развития плода. В зависимости от комбинации антигенов кровь подразделяется на четыре группы. Группа крови не зависит от расы, половой принадлежности, возраста.

Определение групповой принадлежности широко используется в клинической практике при переливании крови и ее компонентов, в гинекологии и акушерстве при планировании беременности.

Группы крови системы АВ0 были открыты в 1900 году К.Ландштейнером, который смешивая эритроциты одних лиц с сывороткой крови других лиц, обнаружил, что при одних сочетаниях кровь свертывается, образуя хлопья (реакция агглютинации), а при других нет. На основании этих исследований Ландштейнер разделил кровь всех людей на три группы: А, В и С. В 1907 году была обнаружена еще одна группа крови.

Система групп крови AB0 является основной системой, определяющей совместимость и несовместимость переливаемой крови, т.к. составляющие ее антигены наиболее иммуногенны. Особенностью системы АВ0 является то, что в плазме у неиммунных людей имеются естественные антитела к отсутствующему на эритроцитах антигену. Систему группы крови АВ0 составляют два групповых эритроцитарных агглютиногена (А и В) и два соответствующих антитела — агглютинины плазмы альфа(анти-А) и бета(анти-В).

Различные сочетания антигенов и антител образуют 4 группы крови:

  •        группа 0(I) — на эритроцитах отсутствуют групповые агглютиногены , в плазме присутствуют агглютинины альфа и бета;
  •        группа А(II) — эритроциты содержат только агглютиноген А, в плазме присутствует агглютинин бета;
  •        группа В(III) — эритроциты содержат только агглютиноген В, в плазме содержится агглютинин альфа;
  •        группа АВ(IV) — на эритроцитах присутствуют антигены А и В, плазма агглютининов не содержит.

Наследование групп крови

В основе закономерностей наследования групп крови лежат следующие понятия. В локусе гена АВО возможны три варианта (аллеля) — 0, A и B, которые экспрессируются по аутосомно-кодоминантному типу. Это означает, что у лиц, унаследовавших гены А и В, экспрессируются продукты обоих этих генов, что приводит к образованию фенотипа АВ (IV).

Фенотип А (II) может быть у человека, унаследовавшего от родителей или два гена А, или гены А и 0. Соответственно фенотип В (III) — при наследовании или двух генов В, или В и 0. Фенотип 0 (I) проявляется при наследовании двух генов 0. Таким образом, если оба родителя имеют II группу крови (генотипы AА или А0), кто-то из их детей может иметь первую группу (генотип 00). Если у одного из родителей группа крови A(II) с возможным генотипом АА и А0, а у другого B(III) с возможным генотипом BB или В0 — дети могут иметь группы крови 0(I), А(II), B(III) или АВ (IV).

Для чего нужно знать группу крови человека

Принадлежность крови к той или иной группе и наличие в ней определенных антител говорит о совместимости (или несовместимости) крови отдельных лиц. Несовместимость может возникнуть, например, при попадании крови плода в организм матери во время беременности (если у матери есть антитела к антигенам крови плода) или при переливании крови другой группы.

При взаимодействии антигенов и антител системы AB0 наступает склеивание эритроцитов (агглютинация или гемолиз), при этом образуются скопления эритроцитов, которые не могут проходить через мелкие сосуды и капилляры и закупоривают их (образуются тромбы). Засоряются почки, возникает острая почечная недостаточность — очень тяжелое состояние, которое, если не принять экстренных мер, приводит к гибели человека.

Резус-фактор

Многим известно, что резус-фактор может стать причиной несовместимости крови матери и плода. Но далеко не все знают, как именно это происходит. Основной механизм развития резус-конфликта уже изучен, тем не менее, многое еще остается непонятным и главные открытия в медицине, в том числе и те, которые касаются резус-фактора, еще впереди

Что такое резус –  фактор (Rh-factor, Rh)?

Резус-фактор — это антиген (белок), который находится на поверхности эритроцитов, красных кровяных телец. Около 85% людей имеют этот самый резус-фактор и, соответственно, являются резус-положительными. Остальные же 15%, у которых его нет, резус-отрицательны.

Обычно отрицательный резус-фактор никаких неприятностей его хозяину не приносит. Особого внимания и ухода требуют лишь резус-отрицательные беременные женщины. Наличие или отсутствие резус-фактора не зависит от групповой принадлежности по системе АВ0 и не изменяется в течение жизни.

Наследование резус-принадлежности крови

В основе наследования лежат следующие понятия. Ген, кодирующий резус-фактор D (Rh), является доминантным, аллельный ему ген d – рецессивным (резус-положительные люди могут иметь генотип DD или Dd, резус-отрицательные только —  dd). Человек получает от каждого родителя по одному гену D или d и таким образом, возможно три варианта наследовании генотипа – DD, Dd или dd. В первых двух случаях (DD и Dd) анализ крови на резус-принадлежность будет положительным. Только при генотипе dd резус-фактор будет отрицательным.

Механизм развития резус-конфликта

Механизм развития резус-конфликтной беременности выглядит следующим образом. В ответ на поступление в кровь беременной резус-отрицательной женщины антигенов резус-фактора в крови у нее вырабатываются антитела, основная масса которых может проникать через плаценту в организм плода, вызывая у него склеивание (гемолиз) эритроцитов, что вызывает повреждение различных органов и тканей плода (особенно страдают печень и головной мозг). Такое состояние ребенка получило название гемолитической болезни новорожденных.

Резус-конфликт не развивается во время первой беременности резус-отрицательной матери резус-положительным плодом. В это время антитела только вырабатываются, но при повторной беременности резус-конфликт неизбежен. В случае, если резус-отрицательная мать, беременна резус-отрицательным ребенком, конфликта не будет ни на первый, ни на последующие разы. Резус-отрицательная кровь отца вызвать резус-конфликт ни в коем случае не может, так как не содержит антигенов.

Гемолитическая болезнь плода и новорожденного

Гемолитическая болезнь плода и новорожденного — это врожденное заболевание, которое характеризуется усиленным распадом эритроцитов ребенка и признаками, обусловленными токсическим (ядовитым) действием продуктов их распада на организм.

При раннем проявлении на 5-6 месяце беременности резус-конфликт может быть причиной преждевременных родов, выкидышей, внутриутробной гибели плода. Основными признаками заболевания является появление нормохромной (в эритроцитах содержится нормальное количество гемоглобина) анемии (снижение числа эритроцитов в крови). Различают отечную, желтушную и анемическую формы гемолитической болезни.

При желтушной форме гемолитической болезни (ядерной желтухе) ребенок рождается в срок с обычными показателями массы тела и неизмененным цветом кожи, но иногда кожа имеет желтушный цвет уже при рождении. Интенсивность желтухи нарастает в ближайшие 2-3 дня, одновременно нарастают и признаки поражения центральной нервной системы (ЦНС) — например, судороги. Прогноз при желтушной форме гемолитической болезни зависти от степени поражения ЦНС.

Анемическая форма гемолитической болезни более благоприятна, она проявляется в основном изменениями в крови. С первых дней у ребенка появляется бледность кожи, особенно выраженная в конце первой и начале второй недели.

Отечная форма (общий врожденный отек) — самая тяжелая форма заболевания. Возникает она обычно во внутриутробном периоде развития, чаще у детей от пятой-седьмой беременности. Дети рождаются бледные, с отеками подкожной клетчатки, наличием жидкости в брюшной и грудной полости, увеличенными печенью и селезенкой. Желтуха отсутствует, так как из-за высокой проницаемости плаценты продукты распада эритроцитов (билирубин) переходят в организм матери и удаляются с желчью. Отечная форма гемолитической болезни почти всегда заканчивается гибелью плода.

Лечение и профилактика гемолитической болезни новорожденных

Основные лечебные мероприятия по борьбе с гемолитической болезнью новорожденных сводятся к быстрейшему выведению из организма продуктов распада эритроцитов и восстановление нормального клеточного состава крови, а также нормальной работы всех органов и систем организма ребенка. С этой целью проводятся вначале заменные, а затем дробные переливания крови, плазмы и плазмозамещающих растворов (например, реополиглюкина).

Для предупреждения рождения детей с гемолитической болезнью всем беременным женщинам проводят исследование крови на резус-фактор, беременных с резус-отрицательной кровью ставят на учет и не рекомендуют прерывать первую беременность.

 

Группа крови и резус фактор

Определяет принадлежность к определенной группе крови по системе АВО.
Группы крови — это генетически наследуемые признаки, не изменяющиеся в течение жизни при естественных условиях. Группа крови представляет собой определённое сочетание поверхностных антигенов эритроцитов (агглютиногенов) системы АВО.
Определение групповой принадлежности широко используется в клинической практике при переливании крови и её компонентов, в гинекологии и акушерстве при планировании и ведении беременности.
Система групп крови AB0 является основной системой, определяющей совместимость и несовместимость переливаемой крови, т. к. составляющие её антигены наиболее иммуногенны. Особенностью системы АВ0 является то, что в плазме у неиммунных людей имеются естественные антитела к отсутствующему на эритроцитах антигену. Систему группы крови АВ0 составляют два групповых эритроцитарных агглютиногена (А и В) и два соответствующих антитела — агглютинины плазмы альфа (анти-А) и бета (анти-В).
Различные сочетания антигенов и антител образуют 4 группы крови:

  1. Группа 0 (I) — на эритроцитах отсутствуют групповые агглютиногены, в плазме присутствуют агглютинины альфа и бета; 
  2. Группа А (II) — эритроциты содержат только агглютиноген А, в плазме присутствует агглютинин бета;
  3.  Группа В (III) — эритроциты содержат только агглютиноген В, в плазме содержится агглютинин альфа; 
  4. Группа АВ (IV) — на эритроцитах присутствуют антигены А и В, плазма агглютининов не содержит.

Определение групп крови проводят путём идентификации специфических антигенов и антител (двойной метод или перекрёстная реакция).
Несовместимость крови наблюдается, если эритроциты одной крови несут агглютиногены (А или В), а в плазме другой крови содержатся соответствующие агглютинины (альфа- или бета), при этом происходит реакция агглютинации. Переливать эритроциты, плазму и особенно цельную кровь от донора к реципиенту нужно строго соблюдая групповую совместимость. Чтобы избежать несовместимости крови донора и реципиента, необходимо лабораторными методами точно определить их группы крови. Лучше всего переливать кровь, эритроциты и плазму той же группы, которая определена у реципиента. В экстренных случаях эритроциты группы 0, но не цельную кровь!, можно переливать реципиентам с другими группами крови; эритроциты группы А можно переливать реципиентам с группой крови А и АВ, а эритроциты от донора группы В — реципиентам группы В и АВ.
Карты совместимости групп крови (агглютинация обозначена знаком «+»)


Кровь донора

Кровь реципиента

0 (I)

A (II)

B (III)

AB (IV)

0 (I)

+

+

+

A (II)

+

+

+

B (III)

+

+

+

AB (IV)

+

+

+

Эритроциты донора

Кровь реципиента

0 (I)

A (II)

B (III)

AB (IV)

0 (I)

A (II)

+

+

B (III)

+

+

AB (IV)

+

+

+


Групповые агглютиногены находятся в строме и оболочке эритроцитов. Антигены системы АВО выявляются не только на эритроцитах, но и на клетках других тканей или даже могут быть растворёнными в слюне и других жидкостях организма. Развиваются они на ранних стадиях внутриутробного развития, у новорожденного уже находятся в существенном количестве. Кровь новорожденных детей имеет возрастные особенности — в плазме могут еще не присутствовать характерные групповые агглютинины, которые начинают вырабатываться позже (постоянно обнаруживаются после 10 месяцев) и определение группы крови у новорожденных в этом случае проводится только по наличию антигенов системы АВО.
Помимо ситуаций, связанных с необходимостью переливания крови, определение группы крови, резус-фактора, а также наличия аллоиммунных антиэритроцитарных антител должно проводиться при планировании или во время беременности для выявления вероятности иммунологического конфликта матери и ребёнка, который может приводить к гемолитической болезни новорожденных.

Гемолитическая болезнь новорожденных
— гемолитическая желтуха новорожденных, обусловленная иммунологическим конфликтом между матерью и плодом из-за несовместимости по эритроцитарным антигенам. Болезнь обусловлена несовместимостью плода и матери по D-резус- или АВО-антигенам, реже имеет место несовместимость по другим резус- (С, Е, с, d, e) или М-, М-, Kell-, Duffy-, Kidd-антигенам. Любой из указанных антигенов (чаще D-резус-антиген), проникая в кровь резус-отрицательной матери, вызывает образование в её организме специфических антител. Последние через плаценту поступают в кровь плода, где разрушают соответствующие антигенсодержащие эритроциты.

Предрасполагают к развитию гемолитической болезни новорожденных нарушение проницаемости плаценты, повторные беременности и переливания крови женщине без учёта резус-фактора и др. При раннем проявлении заболевания иммунологический конфликт может быть причиной преждевременных родов или выкидышей. Существуют разновидности (слабые варианты) антигена А (в большей степени) и реже антигена В. Что касается антигена А, имеются варианты: сильный А1 (более 80%), слабый А2 (менее 20%), и еще более слабые (А3, А4, Ах — редко). Это теоретическое понятие имеет значение для переливания крови и может вызвать несчастные случаи при отнесении донора А2 (II) к группе 0 (I) или донора А2В (IV) — к группе В (III), поскольку слабая форма антигена А иногда обуславливает ошибки при определении группы крови системы АВO. Правильное определение слабых вариантов антигена А может требовать повторных исследований со специфическими реагентами.
Снижение или полное отсутствие естественных агглютининов альфа и бета иногда отмечается при иммунодефицитных состояниях:

  1. новообразования и болезни крови — болезнь Ходжкина, множественная миелома, хроническая лимфатическая лейкемия;
  2. врождённые гипо- и агаммаглобулинемия;
  3. у детей раннего возраста и у пожилых;
  4. иммуносупрессивная терапия;
  5. тяжёлые инфекции.

Трудности при определении группы крови вследствие подавления реакции гемагглютинации возникают также после введения плазмозаменителей, переливания крови, трансплатации, септицемии и пр.
Наследование групп крови
В основе закономерностей наследования групп крови лежат следующие понятия. В локусе гена АВО возможны три варианта (аллеля) — 0, A и B, которые экспрессируются по аутосомно-кодоминантному типу. Это означает, что у лиц, унаследовавших гены А и В, экспрессируются продукты обоих этих генов, что приводит к образованию фенотипа АВ (IV). Фенотип А (II) может быть у человека, унаследовавшего от родителей два гена А или гены А и 0. Соответственно фенотип В (III) — при наследовании двух генов В или В и 0. Фенотип 0 (I) проявляется при наследовании двух генов 0. Таким образом, если оба родителя имеют II группу крови (генотипы AА или А0), кто-то из их детей может иметь первую группу (генотип 00). Если у одного из родителей группа крови A (II) с возможным генотипом АА и А0, а у другого B (III) с возможным генотипом BB или В0 — дети могут иметь группы крови 0 (I), А (II), B (III) или АВ (IV).

 

Показания:

  • Определение трансфузионной совместимости.
  • Гемолитическая болезнь новорожденных (выявление несовместимости крови матери и плода по системе АВ0).
  • Предоперационная подготовка.
  • Беременность (подготовка и наблюдение в динамике беременных с отрицательным резус-фактором).

Результат исследования:

  • 0 (I) — первая группа;
  • A (II) — вторая группа;
  • B (III) — третья группа;
  • AB (IV) — четвертая группа крови.

Основной поверхностный эритроцитарный антиген системы резус, по которому оценивают резус-принадлежность человека.
Антиген Rh — один из эритроцитарных антигенов системы резус, располагается на поверхности эритроцитов. В системе резус различают 5 основных антигенов. Основным (наиболее иммуногенным) является антиген Rh (D), который обычно подразумевают под названием резус-фактор. Эритроциты примерно 85% людей несут этот белок, поэтому их относят к резус-положительным (позитивным). У 15 % людей его нет, они резус-отрицательны (негативны).

Наличие резус-фактора не зависит от групповой принадлежности по системе АВ0, не изменяется в течение жизни, не зависит от внешних причин. Он появляется на ранних стадиях внутриутробного развития, у новорожденного уже обнаруживается в существенном количестве.

Определение резус-принадлежности крови применяется в общей клинической практике при переливании крови и ее компонентов, а также в гинекологии и акушерстве при планировании и ведении беременности.
Несовместимость крови по резус-фактору (резус-конфликт) при переливании крови наблюдается, если эритроциты донора несут Rh-агглютиноген, а реципиент является резус-отрицательным. В этом случае у резус-отрицательного реципиента начинают вырабатываться антитела, направленные против резус-антигена, приводящие к разрушению эритроцитов. Переливать эритроциты, плазму и особенно цельную кровь от донора к реципиенту нужно строго соблюдая совместимость не только по группе крови, но и по резус-фактору.

Присутствие и титр уже имеющихся в крови антител к резус-фактору и других аллоиммунных антител можно определить, указав тест «анти-Rh (титр)».
Определение группы крови, резус-фактора, а также наличия аллоиммунных антиэритроцитарных антител должно проводиться при планировании или во время беременности для выявления вероятности иммунологического конфликта матери и ребёнка, который может приводить к гемолитической болезни новорожденных. Возникновение резус-конфликта и развитие гемолитической болезни новорожденных возможно в том случае, если беременная резус-отрицательна, а плод — резус-положителен. В случае, если у матери Rh +, а плод — резус-отрицателен, опасности гемолитической болезни для плода нет.
Гемолитическая болезнь плода и новорожденных — гемолитическая желтуха новорожденных, обусловленная иммунологическим конфликтом между матерью и плодом из-за несовместимости по эритроцитарным антигенам. Болезнь может быть обусловлена несовместимостью плода и матери по D-резус- или АВО-антигенам, реже имеет место несовместимость по другим резус- (С, Е, с, d, e) или М-, N-, Kell-, Duffy-, Kidd-антигенам (по статистике 98% случаев гемолитической болезни новорожденных связаны с D-резус-антигеном). Любой из указанных антигенов, проникая в кровь резус-отрицательной матери, вызывает образование в её организме специфических антител. Последние через плаценту поступают в кровь плода, где разрушают соответствующие антигенсодержащие эритроциты.

Предрасполагают к развитию гемолитической болезни новорожденных нарушение проницаемости плаценты, повторные беременности и переливания крови женщине без учёта резус-фактора и др. При раннем проявлении заболевания иммунологический конфликт может быть причиной преждевременных родов или повторных выкидышей.

В настоящее время существует возможность медицинской профилактики развития резус-конфликта и гемолитической болезни новорожденных. Все резус-отрицательные женщины в период беременности должны находиться под наблюдением врача. Необходимо также контролировать в динамике уровень резус-антител. Есть небольшая категория резус-положительных лиц, способных образовывать анти-резус антитела. Это лица, эритроциты которых характеризуются значительно сниженной экспрессией нормального антигена Rh на мембране («слабый» D, Dweak) или экспрессией измененного антигена Rh (частичный D, Dpartial). Эти слабые варианты антигена D в лабораторной практике объединяют в группу Du , частота которой составляет около 1%. Реципиенты, содержание антиген Du, должны быть отнесены к резус-отрицательным и им должна быть перелита только резус-отрицательная кровь, так как нормальный антиген D может вызвать у таких лиц иммунный ответ. Доноры с антигеном Du квалифицируются как резус-положительные доноры, так как переливание их крови может вызвать иммунный ответ у резус-отрицательных реципиентов, а в случае предшествующей сенсибилизации к антигену D — и тяжёлые трансфузионные реакции.
Наследование резус-фактора крови. В основе закономерностей наследования лежат следующие понятия. Ген, кодирующий резус-фактор D (Rh), является доминантным, аллельный ему ген d — рецессивным (резус-положительные люди могут иметь генотип DD или Dd, резус-отрицательные — только генотип dd). Человек получает от каждого из родителей по 1 гену — D или d, и у него возможны, таким образом, 3 варианта генотипа — DD, Dd или dd. В первых двух случаях (DD и Dd) анализ крови на резус-фактор даст положительный результат. Только при генотипе dd человек будет иметь резус-отрицательную кровь.
Рассмотрим некоторые варианты сочетания генов, определяющих наличие резус-фактора, у родителей и ребёнка:

  1. отец резус-позитивный (гомозигота, генотип DD), у матери резус-отрицательный (генотип dd). В этом случае все дети будут резус-положительными (вероятность 100%).
  2. отец резус-позитивный (гетерозигота, генотип Dd), мать резус-отрицательная (генотип dd). В этом случае вероятность рождения ребёнка с отрицательным или положительным резусом одинакова и равна 50 %.
  3. отец и мать гетерозиготы по данному гену (Dd), оба резус-позитивны. В этом случае возможно (с вероятностью около 25%) рождение ребёнка с отрицательным резусом.

Результат:

  • Rh (+) положительная;
  • Rh (-) отрицательная.

Информация для доноров — Полезная информация — Редкие фенотипы

Понятие фенотип антигенов эритроцитов человека включает в себя набор антигенов разных систем групп крови, расположенных на поверхности эритроцитов. Этот набор для каждого человека индивидуален. Поэтому при переливании крови и эритроцитарной массы необходимо учитывать совместимость не только по эритроцитарным антигенам системы АВО и резус-фактору, но и по другим эритроцитарным антигенам различных систем.

Антигены системы резус встречаются со следующей частотой: Д – 85 %; С – 70 %; с – 80  %; Е – 30 %; е – 97,5 %. Антигены системы резус обладают способностью вызывать образование иммунных антител. Наиболее активным в этом отношении является антиген Д, который и подразумевается под термином «резус – фактор». Именно по наличию или отсутствию антигена Д все люди делятся на резус – положительных и резус – отрицательных.

 

Распределение фенотипов резус-системы у D-положительных доноров
Фенотипы%
CcDee38
CcDEe17
CCDee22
ccDEe16,6
ccDEE2,4
ccDee3,4
CcDEE0,08
CCDEe0,3

Редким фенотипом крови считается фенотип редко встречающийся в популяции. К   примеру, фенотип  ccddee – резус-отрицательный имеют около 15% населения, а фенотип ссDEE – 2%, (отсутствует антиген е).  Фенотип крови по системе  РЕЗУС (Rh) отрицательный — ссddee или (C-,c+,C W -, D-,E-,e+) относится к редким фенотипам крови. При необходимости переливания крови реципиенту, имеющего такой фенотип, это становится жизненно важно, так как на отсутствующие у реципиента антигены, организм может вырабатывать антитела.

Чтобы избежать всевозможных осложнений, каждому человеку необходимо знать свой фенотип крови. Сделать это можно в специализированной иммуносерологической лаборатории ККЦК №1, где произведут фенотипирование образца вашей крови по всем иммуногенно- значимым системам крови.

 

Genomia: Тестирование кошек: Blood Group DNA test

Группа крови – признак, определяемый индивидуальными антигенными характеристиками эритроцитов – красных кровяных телец крови.
В отличие от человека, собаки, лошади и большинства других видов млекопитающих, для домашней кошки описана только одна система группы крови, включающая два основных типа – группу крови А и группу крови B, а также очень редкую группу крови АB (группы крови принято обозначать латинскими буквами).
Большинство кошек имеет группу крови А, но существует ряд пород, в которых группа B также распространена. Например, частота встречаемости группы крови B у британских кошек, корниш и девон рексов достигает от 25 до 50%, в то время как для сиамской и близких ей пород она крайне редка.

Знание группы крови питомца, как правило, важно в двух случаях:
— при необходимости трансфузии (переливания крови)
— при планировании вязки

Подобно человеческой АB0 системе группы крови, у кошек одной группы в крови присутствуют антитела к другой. Однако антитела разных групп крови проявляют разную активность. Так антитела кошек с группой крови B активно связывают чужеродные эритроциты, содержащиеся в крови кошки с группой А, и уничтожают их, в то время как антитела, циркулирующие в крови кошки группы крови А, проявляют значительно меньшую активность. Интересно отметить, что кошки группы крови АB являются универсальными реципиентами, т.е. не проявляют реакции «отторжения» крови других типов, что связано с отсутствием антител к другим группам.
Котят, родившихся от пары, где кошка имеет группу крови B, а кот – А, может ждать печальная участь – «Синдром внезапной смерти котят». Котята нормально развиваются в утробе матери, но вскоре после рождения умирают.
Первое время иммунная система котенка очень слаба, и мать вместе с молоком передает ему свои антитела, которые всасываются через стенку кишечника малыша и попадают в его кровоток. В случае несовместимости группы крови кошки и котенка (у кошки группа крови B, у котенка — А), антитела матери атакуют эритроциты котенка, вызывая их агглютинацию, т.е. разрушение. В результате у малыша наступают анемия и нарушение обмена веществ, что может привести к смерти.
В некоторых случаях, несмотря на несовместимость, котята выживают. Это связано с индивидуальными особенностями организма, такими как, например, низкая всасываемость стенками кишечника в первые дни после рождения.
В настоящее время группу крови кошки можно определить ДНК-тестом.

Для обозначения групп крови используют следующую генетическую номенклатуру:

Группа крови

Аллель

Генотип

А

А

A/A, A/aab, A/b

АB

аab

aab/aab, aab/b

B

b

b/b

Аллель группы крови А доминантен по отношению к аллелям aabи b, аллель aabдоминирует над аллелем b (А>aab>b). Генетический тест определяет кошек группы крови B, имеющих две копии аллеля b, и кошек-носителей, у которых только одна копия аллеля b. Во втором случае животное может иметь группу крови А или АB. Т.к. генетический тест не разделяет аллели А и aab, для формирования ответа принято использовать условное обозначение non-b аллель

Результаты ДНК-теста:

Генотип

Расшифровка

non b/non b

группа крови А или редкая группа АB

non b/b

группа крови А или АB, носитель группы крови B

b/b

группа крови B

Правильно подобрав пару, можно избежать проблемы гемолиза у потомства. В таблице представлены возможные варианты генотипов котят в зависимости от генотипов родителей.

кот

non-b/non-b

non-b/ b

b/b

non-b/non-b

non-b/non-b

non-b/non-b,   non-b/b

non-b/b

кошка

non-b/b

non-b/non-b,    non-b/b

non-b/non-b,   non-b/b, b/b

non-b/b, b/b

b/b

non-b/b

non-b/b, b/b

b/b

Прим.: голубым цветом выделены генотипы кота, розовым – генотипы кошки, зеленым – генотипы котят. Красным выделены генотипы котят группы риска.

Генетика человека: группа крови ABO

Группы крови ABO: прогнозирование группы крови ваших детей

Вступление

Учебное пособие по генетике человека с упражнениями по решению проблем, касающихся наследования аллелей группы крови ABO, привело к постоянному потоку запросов в Биологический проект от матерей, бабушек и детей, которые спрашивают о возможной группе крови отца данного ребенка.Вот типичный запрос:

Я читал вашу информацию о наследовании групп крови и очень запутался! Я пытаюсь выяснить, какая группа крови отец моего сына мог, так как мы с сыном оба типа А +. Также, мой брат — тип 0, а моя мама — пятерка. Мы не можем найти ничего, что объясняет, как это может быть. Не могли бы вы помочь ???
— От обеспокоенной мамы из Альберты, Канада,
. Человеческие маркеры ABO: аллели A, B и O

Группа крови человека определяется кодоминантными аллелями.Аллель — это одна из нескольких различных форм генетической информации, которая присутствует в нашей ДНК в определенном месте на определенной хромосоме. Есть три разных аллеля группы крови человека, известные как I A , Я B и i. Для простоты мы можем назвать эти аллели A (для I A ), B (для I B ) и O (для i).

У каждого из нас есть два аллеля группы крови ABO, потому что каждый из нас наследует один аллель группы крови от нашей биологической матери и один от нашего биологического отца.Описание пары аллелей в нашей ДНК называется генотипом. Поскольку существует три разных аллеля, всего в генетическом локусе человека ABO имеется шесть различных генотипов. Возможные генотипы — AA, AO, BB, BO, AB и OO.

Как группы крови связаны с шестью генотипами?

Анализ крови используется для определения наличия в образце крови характеристик A и / или B. Невозможно определить точный генотип по результатам анализа крови типа A или типа B.Если у кого-то группа крови A, у него должна быть по крайней мере одна копия аллеля A, но у них может быть две копии. Их генотип — AA или AO. Точно так же человек с группой крови B может иметь генотип BB или BO.

Анализ крови типа AB или O более информативен. Человек с группой крови AB должен иметь аллели как A, так и B. Генотип должен быть AB. У человека с группой крови O нет ни аллелей A, ни B. Генотип должен быть OO.

Как наши дети наследуют аллели ABO?

Каждый биологический родитель жертвует своему ребенку один из двух аллелей ABO.Мать с группой крови O может передать аллель O только своему сыну или дочери. Отец с группой крови AB может передать аллель A или B своему сыну или дочери. У этой пары могли быть дети либо группы крови A (O от матери и A от отца), либо группы крови B (O от матери и B от отца).

Поскольку существует 4 различных группы крови матери и 4 разные группы крови отца, существует 16 различных комбинаций, которые следует учитывать при прогнозировании группы крови детей.В таблицах ниже показаны все 16 возможных комбинаций. Если вы знаете группу крови матери и отца, можно определить возможные группы крови для их детей.

А как насчет резус-фактора? Может ли отец с группой крови A + иметь ребенка с группой крови A-?

Генетическая информация о резус-факторе также передается по наследству от наших родителей, но наследуется независимо от аллелей группы крови ABO. Существует 2 разных аллеля резус-фактора, известных как Rh + и Rh-.У кого-то «Rh-положительный» или «Rh +» есть по крайней мере один аллель Rh +, но может быть и два. Их генотип мог быть либо Rh + / Rh +, либо Rh + / Rh-. Тот, кто Rh- имеет генотип Rh- / Rh-.

Как и в случае с аллелями ABO, каждый биологический родитель жертвует своему ребенку один из двух своих аллелей Rh. Мать-резус-фактор может передать резус-аллель только своему сыну или дочери. Отец с Rh + может передать аллель Rh + или Rh- своему сыну или дочери. У этой пары могли быть Rh + дети (Rh- от матери и Rh + от отца) или Rh- дети (Rh- от матери и Rh- от отца).

Отвечая на вопрос матери из Альберты, Канада

Рассматриваемая мать — группа крови А +. Ее генотип в местонахождении ABO — AA или AO. Ее генотип Rh — либо Rh + / Rh +, либо Rh + / Rh-. Информация о том, что у бабушки по материнской линии также группа крови A +, а у брата — группа крови O, говорит нам, что бабушка по материнской линии ребенка имеет генотип AO, поскольку она принадлежит к типу A, но передала аллель O одному из своих детей.

Мать хочет знать потенциальные группы крови отца ее сына.Сын группы крови А +. К сожалению, в этом конкретном случае мать не может отличить потенциальных отцов только по группе крови. Обратите внимание на таблицу, что эта мать могла родить ребенка с кровью типа A от отца любой из четырех возможных групп крови: типа A, типа AB, типа B или типа O. Аналогичным образом, отцом ребенка может быть любой Rh + или Rh-.

Из этого обсуждения должно быть очевидно, что группа крови не очень хороший тест на отцовство.В некоторых случаях может быть получена однозначная информация, например, мужчина типа AB не может стать отцом ребенка типа O. Однако в большинстве случаев результаты сомнительны.

Если определение отцовства ребенка важно, в настоящее время доступны очень чувствительные ДНК-тесты, которые могут установить отцовство с достоверностью, превышающей 99,99%, или исключить кого-то из биологического отца с абсолютной уверенностью. В другом месте проекта «Биология» есть упражнение по отслеживанию наследования ДНК-маркеров в исследовании отцовства.

Справочные таблицы по группе крови

Материнская
Кровь
Тип
Возможный
Материнский
Генотип
Отцовский
Кровь
Тип
Возможный
Отцовский
Генотип
Возможно
Ребенок
Группа крови
А АА, АО A АА, АО А, О
А АА, АО AB AB A, AB, B
А АА, АО B BB, BO A, AB, B, O
А АА, АО O OO А, О
Материнская
Кровь
Тип
Возможный
Материнский
Генотип
Отцовский
Кровь
Тип
Возможный
Отцовский
Генотип
Возможно
Ребенок
Группа крови
AB AB A АА, АО A, AB, B
AB AB AB AB A, AB, B
AB AB B BB, BO A, AB, B
AB AB O OO А, В
Материнская
Кровь
Тип
Возможный
Материнский
Генотип
Отцовский
Кровь
Тип
Возможный
Отцовский
Генотип
Возможно
Ребенок
Группа крови
B BB, BO A АА, АО A, AB, B, O
B BB, BO AB AB A, AB, B
B BB, BO B BB, BO B, O
B BB, BO O OO B, O
Материнская
Кровь
Тип
Возможный
Материнский
Генотип
Отцовский
Кровь
Тип
Возможный
Отцовский
Генотип
Возможно
Ребенок
Группа крови
О OO A АА, АО А, О
О OO AB AB А, В
О OO B BB, BO B, O
О OO O OO O

Ричард Б.Халлик
Университет Аризоны
26 авг.1997 г.
[email protected]

http://www.blc.arizona.edu/
Все права защищены © 1997. Все права защищены.

Учебное пособие по группам крови

Вступление

Маркеры АВО человека

Группы крови и генотипы?

Как наши дети наследуют аллели ABO?


Калькулятор группы крови и резус-фактора

Калькулятор группы крови

Резус-фактор

Набор задач
Анализ крови используется для определения наличия в образце крови характеристик A и / или B.Невозможно определить точный генотип по результатам анализа крови типа A или типа B.
Если у кого-то группа крови A, у него должна быть по крайней мере одна копия аллеля A, но у них может быть две копии. Их генотип — AA или AO. Точно так же человек с группой крови B может иметь генотип BB или BO.
Группа крови Возможные генотипы
А AA
АО
B BB
BO
Анализ крови типа AB или O более информативен.Человек с группой крови AB должен иметь аллели как A, так и B. Генотип должен быть AB. У кого-то с группой крови O нет ни A, ни аллель B. Генотип должен быть OO.
Группа крови Возможные генотипы
AB AB
О OO

Генотипирование по группе крови | Кровь

Аллоиммунизация — серьезное осложнение хронического переливания крови, особенно для пациентов с ВСС и β-талассемией.Многие программы пытаются предотвратить или снизить риск аллоантител путем переливания донорских единиц, которые соответствуют антигенам D, C, E и K, 20-23,24 , а некоторые включают Fy a / b , Jk a / b и S. 25 Рекомендуется выполнение расширенного антигенного профиля у пациентов с ВСС перед первым переливанием (комитет Американского общества гематологов по разработке руководящих принципов лечения ВСС, рукопись в стадии подготовки). Это может быть выполнено серологическим типированием или методами ДНК, хотя генотипирование повышает точность и дает больше информации. 13 Например, генотипирование эритроцитов выявляет ~ 20% пациентов с ВСС, у которых эритроциты типа C + , но у которых изменен антиген C. Они должны получить донорские единицы C , потому что в нескольких когортах было показано, что одна треть этих пациентов вырабатывает анти-C при переливании донорских единиц C + . 23,26 Генотипирование также позволяет выявлять пациентов, у которых отсутствуют антигены с высокой распространенностью, и, хотя профилактика часто невозможна, наличие этой информации позволяет избежать ошибочного диагноза, потому что антитела в лабораторных исследованиях окажутся теплыми аутоантителами.Генотипирование также предупреждает службу переливания крови о несовместимости в Dombrock (Doa / b, Joa, Hy), других Kell (Kpa / b, Jsa / b), других Rh (V / VS) и Colton (Coa / b), Yt. (a / b), лютеранская (Lua / b), Diego (Dia / b) и Scianna (Sc1 / 2) системы. Эти антитела могут быть клинически значимыми и опасными для жизни, но их трудно идентифицировать; ранее не было доступных методов для типографских доноров для поиска совместимых единиц. Несовместимость этих систем следует учитывать, когда наблюдается гемолиз перелитых эритроцитов в отсутствие обнаруживаемых новых антител.

Пациенты с SCD иногда вырабатывают резус-антитела, несмотря на серологическое соответствие антигенов D, C и E. Эти антитела обнаруживаются у пациентов с многократным переливанием крови, чьи эритроциты положительны по антигену при серологическом типировании или отрицательны по антигену, но не подвергались воздействию антигена на донорских эритроцитах, как определено серологическим типированием. 23,27 Это происходит потому, что эпитопы Rh сложны, а гены RH у лиц африканского черного фона разнообразны.Следовательно, и пациенты, и афроамериканские доноры, часто используемые для переливания, имеют аллели RHD и RHCE, кодирующие эпитопы Rh, серологическая реактивность которых не является однозначной. 27-29 В целом, около 6% афроамериканцев с RhD + с SCD имеют риск клинически значимого анти-D, около 21% пациентов с C + имеют риск анти-C и 21% подвержены риску появления анти-с или анти-е, если профилактическое соответствие основано на серологическом исследовании. 27 Подобно HLA, некоторые пациенты с SCD не имеют достаточного соответствия Rh-антигену по серологическому типированию, чтобы избежать аллоиммунизации; тогда требуется набор текста с высоким разрешением.Важно отметить, что частоты аллелей RH схожи между пациентами с SCD и афроамериканскими донорами крови, что позволяет предположить, что сопоставление RH с более высоким разрешением с помощью RH-генотипирования будет потенциально возможным в будущем и позволит лучше использовать инвентаризацию доноров крови афроамериканцев. 27

17.6: Группы крови — Biology LibreTexts

Дар жизни

Вы когда-нибудь сдавали кровь, как это делает человек на этой фотографии? Если да, то вы, вероятно, знаете, что ваша группа крови является важным фактором при переливании крови.Люди различаются по типу крови, которую они наследуют, и это определяет, какой тип крови они могут безопасно получить при переливании. Знаете ли вы свою группу крови?

Рисунок \ (\ PageIndex {1} \): сдача крови

Что такое группы крови?

Группа крови (или группа крови) — это генетическая характеристика, связанная с присутствием или отсутствием определенных молекул, называемых антигенами, на поверхности эритроцитов. Эти молекулы могут помочь поддерживать целостность клеточной мембраны, действовать как рецепторы или выполнять другие биологические функции.Система группы крови относится ко всем генам, аллелям и возможным генотипам и фенотипам, которые существуют для определенного набора антигенов группы крови. Системы групп крови человека включают хорошо известные системы ABO и резус (Rh), а также по меньшей мере 33 других, менее известных.

Антигены и антитела

Антигены , такие как те, что находятся в красных кровяных тельцах, представляют собой молекулы, которые иммунная система определяет как собственные (производимые вашим собственным телом) или чужие (не производимые вашим собственным телом).Антигенами группы крови могут быть белки, углеводы, гликопротеины (белки, прикрепленные к цепочкам сахаров) или гликолипиды (липиды, прикрепленные к цепочкам сахаров), в зависимости от конкретной системы группы крови. Если антигены идентифицированы как чужие, иммунная система отвечает образованием антител, специфичных к чужеродным антигенам. Антитела — это большие Y-образные белки, продуцируемые иммунной системой, которые распознают и связываются с чужеродными антигенами. Аналогия замка и ключа часто используется для представления того, как антитело и антиген сочетаются друг с другом, как показано на иллюстрации ниже.Когда антитела связываются с антигенами, они помечают их для разрушения другими клетками иммунной системы. Неличные антигены могут попадать в ваш организм через патогены, такие как бактерии или вирусы, продукты питания или красные кровяные тельца при переливании крови от человека с другой группой крови, чем ваша собственная. Последний способ в настоящее время практически невозможен из-за эффективных протоколов определения группы крови и скрининга.

Рисунок \ (\ PageIndex {2} \): Модель антигена и соответствующего антитела

Генетика группы крови

Группа крови человека зависит от того, какие аллели системы группы крови унаследованы от родителей.Обычно группа крови контролируется аллелями одного гена или двух или более очень тесно связанных генов. Тесно связанные гены почти всегда наследуются вместе, потому что рекомбинация между ними незначительна или отсутствует. Как и другие генетические особенности, группа крови человека обычно фиксируется на всю жизнь, но в редких случаях группа крови может измениться. Это может произойти, например, если человеку сделают трансплантацию костного мозга для лечения такого заболевания, как лейкемия. Если костный мозг поступает от донора с другой группой крови, группа крови пациента может в конечном итоге преобразоваться в группу крови донора, поскольку в костном мозге вырабатываются эритроциты.

Система групп крови ABO

    Рисунок \ (\ PageIndex {3} \): Молекулы антигена ABO

    Система групп крови ABO — самая известная система групп крови человека. Антигенами в этой системе являются гликопротеины. Эти антигенные соединения показаны на рисунке \ (\ PageIndex {3} \). Для системы ABO существует четыре общие группы крови:

    1. Тип A, в котором присутствует только антиген A
    2. Тип B, в котором присутствует только антиген B
    3. Тип AB, в котором присутствуют антигены A и B
    4. Тип O, в котором нет ни антигена A, ни B

    Генетика системы ABO

    Система групп крови ABO контролируется одним геном на хромосоме 9. B \) AB Рисунок \ (\ PageIndex {4} \): Пример наследования группы крови ABO.Мужчина типа A (генотип AO) и женщина типа B (генотип BO) могут иметь детей с группами крови: A, AB, B и O.

    Диаграмма на рисунке \ (\ PageIndex {4} \) показывает пример того, как наследуется группа крови ABO. В этом конкретном примере отец имеет группу крови A (генотип АО), а мать — группу крови B (генотип BO). Этот тип спаривания может производить детей с каждым из четырех возможных фенотипов ABO, хотя в любой данной семье не все фенотипы могут присутствовать у детей.

    Медицинское значение группы крови ABO

    Система ABO — самая важная система группы крови при переливании крови. Если эритроциты, содержащие определенный антиген ABO, переливаются человеку, у которого отсутствует этот антиген, иммунная система человека распознает антиген в эритроцитах как чужеродный. Антитела, специфичные к этому антигену, будут атаковать красные кровяные тельца, заставляя их агглютинировать или слипаться и разрушаться. Если пациенту случайно переливают несовместимую кровь, может возникнуть тяжелая реакция (называемая острой гемолитической трансфузионной реакцией), при которой многие эритроциты разрушаются.Это может привести к почечной недостаточности, шоку и даже смерти. К счастью, сегодня таких несчастных случаев практически не бывает.

    Антитела

    ABO, скорее всего, уже присутствуют в крови реципиента в отношении антигенов, которых у человека нет. Эти антитела вырабатываются в первые годы жизни путем сенсибилизации к аналогичным антигенам, обычно встречающимся в окружающей среде. Считается, что антитела против A возникают в результате иммунного ответа на антиген вируса гриппа, а антитела против B возникают в результате иммунного ответа на антиген, обнаруженный у бактерий, таких как E.coli . После выработки антител они циркулируют в плазме. Взаимосвязь между антигенами эритроцитов ABO и антителами плазмы показана в таблице ниже.

    Рисунок \ (\ PageIndex {5} \): Циркулирующие в плазме антитела относятся к антигенам, отличным от тех, которые содержатся в красных кровяных тельцах, которые распознаются как аутоантигены.

    Какие группы крови совместимы, а какие нет? Кровь типа O содержит как анти-A, так и анти-B антитела, поэтому люди с кровью типа O могут получать только кровь типа O.Однако они могут сдавать кровь людям любой группы крови ABO. Вот почему людей с кровью группы O называют универсальными донорами. Кровь типа AB не содержит ни анти-A, ни анти-B антител, поэтому люди с кровью типа AB могут получать кровь от людей с любой группой крови ABO. Вот почему людей с кровью типа AB называют универсальными реципиентами. Однако они могут сдавать кровь только людям, у которых также есть кровь группы AB. Эти и другие отношения между группами крови доноров и реципиентов резюмированы на простой диаграмме ниже.

    Рисунок \ (\ PageIndex {6} \): вы всегда можете сдать кровь тому, кто имеет ту же группу крови, что и ваша, но вы можете или не сможете сдать кровь людям с другими группами крови, как показано на этой диаграмме. .

    Антигены группы крови ABO обнаруживаются не только на эритроцитах, но и на тромбоцитах, в других жидкостях организма, таких как слезы и моча, а также на клетках других типов тканей. Совместимость групп крови важна для успешной трансплантации органов. Если трансплантированный орган имеет чужеродные антигены для ABO, он может быть атакован антителами и отторгнут организмом.

    Система групп крови резус

    Другая хорошо известная система групп крови — это резус (Rh) система группы крови . В системе резус есть десятки различных антигенов, но только пять основных антигенов (с названиями D, C, c, E и e). Основным антигеном резуса является антиген D. Людей с антигеном D называют резус-положительными (Rh +), а людей, у которых отсутствует антиген D, называют резус-отрицательными (Rh-). Считается, что резус-антигены играют роль в транспортировке ионов через клеточные мембраны, действуя как канальные белки.

    Система группы крови резус контролируется двумя сцепленными генами на хромосоме 1. Один ген, называемый RHD, продуцирует единственный антиген, антиген D. Другой ген, называемый RHCE, продуцирует другие четыре относительно общих антигена резуса (C, c, E и e), в зависимости от того, какие аллели этого гена передаются по наследству.

    Группа крови резус и переливания

    После системы ABO, резус-система является второй по важности системой групп крови при переливании крови. Антиген D с наибольшей вероятностью вызывает иммунный ответ у людей, у которых этот антиген отсутствует.Людям с антигеном D (Rh +) можно безопасно переливать кровь Rh + или Rh-, тогда как людям, у которых отсутствует антиген D (Rh-), можно безопасно переливать только кровь Rh-.

    В отличие от антител анти-A и анти-B к антигенам ABO, антитела анти-D для системы резус обычно не образуются путем сенсибилизации к веществам окружающей среды. Однако люди, у которых отсутствует антиген D (Rh-), могут вырабатывать анти-D антитела при контакте с Rh + кровью. Это может произойти случайно при переливании крови, хотя сегодня это крайне маловероятно.Это также может произойти во время беременности с Rh + плодом, если некоторые из клеток крови плода попадают в кровоток матери.

    Гемолитическая болезнь новорожденных

    Если женщина с резус-фактором- вынашивает плод с резус-фактором +, плод может быть в группе риска. Это особенно вероятно, если у матери образовались антитела к D во время предыдущей беременности из-за смешивания крови матери и плода во время родов. В отличие от антител против антигенов ABO, антитела против антигена резуса D могут проникать через плаценту и попадать в кровь плода.Это может вызвать гемолитическую болезнь новорожденных (HDN) , также называемую эритробластозом плода, заболевание, при котором эритроциты плода разрушаются материнскими антителами, вызывая анемию. Эта болезнь может варьироваться от легкой до тяжелой. В тяжелых случаях это может привести к повреждению головного мозга и иногда к летальному исходу для плода или новорожденного. К счастью, HDN можно предотвратить, предотвратив образование анти-D антител в Rh-матери. Это достигается путем инъекции матери лекарства под названием иммуноглобулин Rho (D).

    Характеристика: мифы против реальности

    Миф: Ваши потребности в питании могут определяться вашей группой крови ABO. Зная свою группу крови, вы можете выбрать подходящие продукты, которые помогут вам похудеть, повысить уровень энергии и прожить более долгую и здоровую жизнь.

    Реальность: Эта идея была предложена в 1996 году в бестселлере New York Times Правильно питайтесь для своего типа натуропатом Питером Д’Адамо.Натуропатия — это метод лечения заболеваний, связанных с использованием трав, солнечного света, свежего воздуха и других природных веществ. Некоторые врачи считают натуропатию лженаукой. В крупном научном обзоре диеты по группе крови не было обнаружено никаких доказательств, подтверждающих это. В одном исследовании взрослые, соблюдающие диету, предназначенную для группы крови А, показали улучшение здоровья, но это произошло у всех, независимо от их группы крови. Поскольку диета по группе крови основана исключительно на группе крови, она не учитывает другие факторы, которые могут потребовать корректировок или ограничений диеты.Например, люди с диабетом, но с разными группами крови, будут придерживаться разных диет, и одна или обе диеты могут противоречить стандартным диетическим рекомендациям при диабете и быть опасными.

    Миф: Группа крови ABO связана с определенными чертами личности. Например, люди с группой крови A терпеливы и ответственны, но также могут быть упрямыми и напряженными, тогда как люди с группой крови B энергичны и креативны, но также могут быть безответственными и беспощадными.При выборе супруга следует принимать во внимание как вашу собственную группу крови, так и группу крови вашего потенциального партнера, чтобы обеспечить совместимость вашей личности.

    Реальность: Вера в то, что группа крови коррелирует с личностью, широко распространена в Японии и других странах Восточной Азии (японский киоск, изображенный ниже, предлагает состояния, основанные на группе крови). Идея была впервые представлена ​​в 1920-х годах в исследовании, проведенном по заказу правительства Японии, но, как выяснилось позже, не имеет научной поддержки.Эта идея была возрождена в 1970-х годах японским телеведущим, написавшим об этом популярные книги. У этой идеи нет научного обоснования, и она обычно отвергается научным сообществом как псевдонаука. Тем не менее, она остается популярной в странах Восточной Азии, как и астрология во многих других странах.

    Сводка

    • Группа крови (или группа крови) — это генетическая характеристика, связанная с наличием или отсутствием антигенов на поверхности эритроцитов. Система группы крови относится ко всем генам, аллелям и возможным генотипам и фенотипам, которые существуют для определенного набора антигенов группы крови.
    • Антигены — это молекулы, которые иммунная система идентифицирует как собственные или чужие. Если антигены идентифицируются как чужие, иммунная система отвечает образованием антител, специфичных к чужеродным антигенам, что приводит к разрушению клеток, несущих антигены.
    • Система групп крови ABO — это система антигенов эритроцитов, контролируемая одним геном с тремя общими аллелями на хромосоме 9. Существует четыре возможных группы крови ABO: A, B, AB и O.Система ABO — самая важная система группы крови при переливании крови. Люди с кровью типа O являются универсальными донорами, а люди с кровью группы AB — универсальными реципиентами.
    • Система групп крови резус — это система антигенов эритроцитов, контролируемая двумя генами с множеством аллелей на хромосоме 1. Существует пять общих антигенов резуса, из которых антиген D является наиболее значимым. Людей, у которых есть антиген D, называют Rh +, а людей, у которых нет антигена D, называют Rh-.Rh- матери Rh + плодов могут продуцировать антитела против антигена D в крови плода, вызывая гемолитическую болезнь новорожденных (HDN).

    Обзор

    1. Определите группу крови и систему группы крови.
    2. Объясните взаимосвязь между антигенами и антителами.
    3. Определите аллели, генотипы и фенотипы в системе групп крови ABO.
    4. Обсудите медицинское значение системы групп крови ABO.
    5. Приведите примеры того, как разные группы крови ABO различаются по восприимчивости к заболеваниям.
    6. Опишите систему групп крови резус.
    7. Связать группы крови резус с переливаниями крови.
    8. Что вызывает гемолитическую болезнь новорожденного?
    9. Женщина имеет группу крови O и Rh-, а ее муж — группу крови AB и Rh +. Ответьте на следующие вопросы об этой паре и их потомстве.

      а. Каковы возможные генотипы их потомков по группе крови ABO?

      г. Каковы возможные фенотипы их потомков с точки зрения группы крови ABO?

      г.Может ли женщина сдать кровь мужу? Поясните свой ответ.

      г. Может ли мужчина сдать кровь жене? Поясните свой ответ.

    10. Верно или неверно. Антиген D является частью системы группы крови ABO.

    11. Объясните, почему гемолитическая болезнь новорожденного может быть более вероятна при второй беременности, чем при первой.

    Узнать больше

    Является ли малярия причиной того, что у многих людей кровь группы O? Послушайте это увлекательное интервью National Public Radio с доктором Дж.Кристин Черти-Газдевич, специалист по крови (гематолог) из Университета Торонто, которая обсуждает возникающую теорию универсальной крови.

    На поведение человека влияет множество факторов … но может ли оно быть результатом паразитизма? Узнайте больше здесь:

    Определение генотипов группы крови ABO с использованием метода изотермической амплификации в реальном времени с использованием петли

    Введение

    Группа крови АВО, обнаруженная при начало 20 века Карла Ландштейнера остается наиболее важной группой крови с клинической точки зрения (1–3).В 1924 г. эта группа крови была разделена на четыре антигена (A, B, O и AB) и шести генотипов (AA, AO, BB, BO, OO и AB). Это один из обычные полиморфизмы групп крови, которые важны для генетические маркеры в анализе сцепления, переливании крови, личном идентификация и выявление заболеваний (4,5).

    Для ABO использовался ряд методов. генотипирование, включая ограничение полимеразной цепной реакции (ПЦР) полиморфизм длины фрагмента, однониточная конформация ПЦР полиморфизм, аллель-специфическая ПЦР, длина продукта, амплифицированного ПЦР полиморфизм, обратная транскрипция-количественная (RT-q) ПЦР и ДНК чип (3,6–8).Однако эти методы трудоемки и невыгодны из-за к требованию трудоемкой пост-амплификации процедуры, включая рестрикционный электрофорез и ферментный расщепление или использование ДНК-зондов с радиоактивной меткой. Следовательно, более простой, быстрый и информативный метод генотипирования аллелей ABO.

    Настоящее исследование направлено на улучшение НПА. метод генотипирования, основанный на LAMP, который напрямую использует одноэтапный изотермическая реакция для определения шести вышеупомянутых генотипов.Разработанная методика явилась мощным инновационным геном. амплификационный подход как простой быстрый инструмент для клинических обнаружение и идентификация.

    Материалы и методы
    Образцы и выделение ДНК

    образцов периферической крови было взято у 101 неродственных китайских добровольцев в пробирки, покрытые ЭДТА, в Шэньси. Провинциальная народная больница (Сиань, Китай) с информированного согласия. Исследование было одобрено этическим комитетом Колледжа Науки о жизни, Северо-Западный университет (Сиань, Китай).НПА фенотипы всех образцов крови были идентифицированы серологическим методом. методы, основанные на антигенах группы крови АВО, присутствующих в эритроците клетки и антитела IgM, присутствующие в сыворотке. Геномная ДНК из добровольцев выделяли из 1 мл крови с помощью цельной крови. Набор для выделения геномной ДНК (Xi’an GoldMag Nanobiotech Co., Ltd., Сиань, Китай) согласно инструкции производителя.

    Дизайн и синтез праймеров

    Два однонуклеотидных полиморфизма (SNP) на нуклеотиды 261 и 803, расположенные на экзонах 6 и 7 гена ABO, которые охватывают наиболее полиморфные сайты полного ABO последовательности, показанные на рис.1 (9). Набор праймеров для амплификации LAMP включает набор из четырех праймеров, включающий два внешних и два внутренних праймера, которые распознают шесть различных области на целевой последовательности, обозначенные на фиг. 1. Таблица Я перечисляю последовательности праймеров для типирования, используемых для LAMP. реакция. Все олигонуклеотидные праймеры были синтезированы Пекином. Институт геномики (BGI; Пекин, Китай).

    Таблица I

    Последовательности типирующих праймеров, используемых для изотермическая реакция амплификации, опосредованная петлей в реальном времени.

    Таблица I

    Последовательности типирования праймеров, используемых для изотермическая реакция амплификации, опосредованная петлей в реальном времени.

    Аллель Праймер Последовательность (5 ‘→ 3’)
    нуклеотид 261 для O тест O-F3 TGTGCCAGAGGCGCAT
    O-B3 TGATGGCAAACACAGTTAAC
    O-FIP TACCACGAGGACATCCTTCCTCCTGCCAGCTCCATGTGA
    O-BIP ACCCCTTGGCTGGCTCCTGGAGCCTGAACTGCTCGT
    Non-O-FIP CACCACGAGGACATCCTTCCTCCTGCCAGCTCCATGTGA
    Non-O-BIP GACCCCTTGGCTGGCTCCTGGAGCCTGAACTGCTCGT
    nt 803 для B тест B-F3 TGACTGGTTCGGCACCCT
    B-B3 TGCCGTTGGCCTGGTCGAC
    В-МФФ TGTAGTAGAAATCGCCCTTCACGGAAGCAGCCGGGA
    В-BIP CGTTCTTCGGGGGGTCGGTCCGGTACTACCA
    не-B-МФФ GGTAGTAGAAATCGCCCTTCACGGAAGCAGCCGGGA
    не-B-BIP GGTTCTTCGGGGGGTCGGTCCGGTACTACCA
    Усиление мишени с помощью LAMP

    Каждый анализ проводился путем исследования образцов подготовили кровь от каждого человека к четырем амплификациям LAMP.В двух реакциях использовался набор праймеров O или B, а в других реакциях. использовали набор праймеров, отличных от O или B. Каждая реакция включала прямой / обратный праймер (F3 / B3). Амплификация проводилась в конечный объем 25 мкл, содержащий 0,8 мкМ вперед внутренний праймер и обратный внутренний праймер, 0,2 мкМ F3 и B3 праймеры, 15 мкл изотермической мастер-смеси (IMM; OptiGene, Хоршем, Великобритания) и 50 нг геномной ДНК. Условия реакции были оптимизированы для обеспечения высокой специфичности амплификаций, включая оценку концентрации праймера, подготовки крови концентрация и температура реакции.Анализы LAMP были выполняется в 8-луночных стрипах путем инкубации при 62 ° C в течение 40 мин. Одновременно интенсивность флуоресценции флуоресцентного красителя, содержащаяся в IMM, контролировалась с помощью системы Genie II (OptiGene).

    Прямое секвенирование ПЦР товары

    Для секвенирования образцов фрагмент 200 п.н. для экзона 6 и фрагмент 740 п.н. для экзона 7 амплифицировали с использованием следующие две пары праймеров, синтезированные BGI: Экзон 6, вперед: 5′-TCCATGTGACCGCACGCCTC-3 ′ и наоборот: 5′-GGGTCTCTACCCTCGGCCACC-3 ‘; экзон 7, вперед: 5’-CCGTGTCCACTACTATGTCTTCACC-3 ‘и наоборот: 5’-ACAACAGGACGGACAAAGGAAACAG-3 ‘.Продукты ПЦР секвенировали BGI.

    Результаты и обсуждение

    Используя этот метод, базовые замены в двух SNP сайтов в гене ABO (нуклеотиды 261 и 803) были обнаружены одновременно четырьмя праймерами, устанавливая реакцию удлинения на различают шесть генотипов (AA, AO, BB, BO, OO и AB). в в случае гаплотипов положительная аллель-специфическая реакция исключена соответствующая положительная неаллель-специфическая реакция и наоборот наоборот. Аллель B был отличен от праймера, отличного от B, на нуклеотид 803 и аллель O отличался от не-O в нуклеотид 261.Сводка всех возможных шаблонов указана в Таблица II и репрезентативные данные показаны на рис. 2.

    Таблица II

    Возможные шаблоны, обнаруженные с помощью изотермическая амплификация и статистическая результаты генотипирования 101 отобранного человека.

    Таблица II

    Возможные шаблоны, обнаруженные с помощью изотермическая амплификация и статистическая результаты генотипирования 101 отобранного человека.

    Фенотип Генотип Набор праймеров B Набор праймеров не B Набор праймеров O Набор праймеров O Кол-во человек идентифицировано (n = 101) Расчетный генотип частота (%)
    A AA + + 6 5.94
    A AO + + 38 37.62
    B BB + + 12 11,88
    B BO + + + + + + 28,71
    AB AB + + + 8 7,92
    O OO + 8 7.92

    Был проведен пул из 101 образца крови от китайских доноров. оценивается с помощью LAMP. Обнаруженные генотипы вместе с их частоты, приведены в таблице II. Наблюдаемые частоты аллелей были: 28,71, 30,20 и 41,09% для A, B и O соответственно (Рассчитано из: A: (AA + AO / 2 + AB / 2) / 101; B: (BB + BO / 2 + AB / 2) / 101; O: (AO / 2 + BO / 2 + OO) / 101), из которых были рассчитаны частоты фенотипов, равные 43,56, 40,59, 7,92 и 7,92% для A, B, AB и O соответственно (рассчитано из: Фенотипы / 101).Результаты сравнивали с фенотипы, определенные серологическим анализом, и генотипы определено прямым секвенированием, расхождений не выявлено. наблюдаемый.

    Система групп крови ABO была первой группой крови система должна быть идентифицирована и широко использовалась в качестве маркера в популяционных исследованиях, эпидемиологии и судебно-медицинской экспертизе (10). Группа крови ABO фундаментальное значение для трансфузионной медицины, поскольку точное тестирование донор и реципиент крови важны для предотвращения гемолитические трансфузионные реакции и гемолитическая болезнь новорожденный (11,12).Группа крови ABO также имеет решающее значение. для оценки риска развития определенных злокачественных новообразований (13,14) и сердечно-сосудистые заболевания (5,15). На сегодняшний день было сообщено о нескольких методах генотипирования ABO, которые полагаются преимущественно на дифференциацию A, B и O при определенных базовые замены.

    Однако технические ошибки и несколько клинических состояния или заболевания могут привести к несоответствию между эритроцитов и сывороток, что приводит к неправильному генотипу определены (3,16–18). В результате привлекает внимание появляющийся новый подход, LAMP. его практичности, скорости и полезности в лабораториях и клинические условия (19–21).

    LAMP — простой, быстрый и точный ген техника усиления с использованием набора из четырех специально разработанных праймеры для охвата шести отдельных областей гена-мишени. В процедура амплификации проста и быстра, при этом весь процедура может быть завершена за один шаг, инкубируя все реагенты (образцы, праймеры, ДНК-полимераза со смещением цепи активности и субстратов) в одной трубке под изотермическим условия, которые могут быть выполнены менее чем за 1 час, при этом ДНК усилены в 10–9–10–10 раз (22).

    Основной характеристикой LAMP является ее преимущество простоты реакции и более высокой эффективности амплификации. в В настоящем исследовании процедура амплификации ДНК составляла <40 мин при постоянная температура 62 ° C, что позволяет без потери времени на тепловое изменение. ДНК-полимераза обеспечивает высокую амплификацию эффективность в результате его высокой специфичности и наличия последовательность целевого гена легко обнаруживается путем оценки наличия усиленных продуктов. Кроме того, отсутствует денатурация двойного требуется одноцепочечная ДНК в одноцепочечную ДНК.Кроме того, более чувствительный детектор сигналов, GENIE II, помогает в быстрая обработка данных. Поездка до пик, а затем еще 20 минут для завершения всей реакции, что относительно быстрее по сравнению с обычным методом ПЦР. анализы.

    Вторая характеристика LAMP — это превосходное специфичность. Ранее сообщалось, что обнаружение предел анализа LAMP был в 10 раз ниже по сравнению с RT-qPCR и в 104 раза ниже по сравнению с обычной ПЦР (22,23).Однако системы LAMP с высоким чувствительность может привести к ложноположительным результатам. В настоящее время исследования были взяты образцы крови 101 китайца. успешно генотипирован с использованием ДНК периферической крови и без ложных положительная реакция наблюдалась, по данным прямого последовательность действий.

    С использованием четырех праймеров, предназначенных для распознавания шесть отдельных регионов, только целевой SNP строго и специально усиленный, даже при сосуществовании с его гомологичными ген. Реакция настолько специфична, что позволяет строго различать однонуклеотидные различия.Эти результаты показали, что разработанные четыре набора праймеров были чрезвычайно специфичны для двух SNP сайтов в гене ABO. Также применение IMM, в том числе флуоресцентный краситель, снижает риск перекрестного загрязнения из-за уменьшение открывания крышки.

    В заключение, анализ LAMP, разработанный в настоящее исследование имеет большой потенциал для быстрого генотипирования ABO, которое может применяться в лабораториях и клинических условиях. Это также предполагалось, что несколько других известных SNP также могут быть обнаружены этот метод с соответствующими наборами праймеров.Принимая во внимание преимущества быстрого усиления, легкого обнаружения и простого операции, LAMP может предложить больше приложений для точек обслуживания тестирование.

    Благодарности

    Настоящее исследование поддержано Проектом Национальные великие исследования и разработки новых лекарств Китая (No. 2012ZX09506001–001) и грант Национального института Здоровье (№ P20RR016457 из Программы INBRE Национального Центр исследовательских ресурсов).

    Список литературы

    1

    Landsteiner K: Zur Kenntnis der antifermentativen, lytischen und agglutinierenden Wirkungen des Blutserums und der Lymphe.Zbl Bakt. 27: 357–362. 1900.

    2

    Сторри-младший и Олссон МЛ: кровь НПА Пересмотр групповой системы: обзор и обновление. Иммуногематология. 25: 48–59. 2009 г., PubMed / NCBI

    3

    Franchini M и Liumbruno GM; ABO кровь группа: Старая догма, новые перспективы. Clin Chem Lab Med. 51: 1545–1553. 2013.PubMed / NCBI

    4

    Сано Р., Такахаши И., Накадзима Т., Ёси М., Кубо Р., Такахаши К., Коминато Ю., Такешита Х., Ясуда Т., Цунэяма H и др.: Химеризм ABO с минорным аллелем, обнаруженным пептидом Метод зажима, опосредованный нуклеиновой кислотой, полимеразной цепной реакцией.Переливание крови. 12: 431–434. 2014.PubMed / NCBI

    5

    Dentali F, Sironi AP, Ageno W, Crestani S и Franchini M: Группа крови ABO и сосудистые заболевания: обновление. Semin Thromb Hemost. 40: 49–59. 2014.PubMed / NCBI

    6

    Флегель В.А.: Генотипирование по системе ABO: поиски клиническое применение. Переливание крови. 11: 62013.

    7

    Ватанабэ К., Икегая Х, Хираяма К., Мотани Х, Ивасе Х, Канеко Х, Фукусима Х, Акуцу Т и Сакурада К. Роман метод АВО-генотипирования с использованием ДНК-чипа.J Forensic Sci. 56 (Дополнение 1): S183 – S187. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    8

    Ватанабэ Дж., Умецу К., Юаса И. и Сузуки T: Полиморфизм длины амплифицированного продукта (APLP): новая стратегия для генотипирования группы крови АВО. Hum Genet. 99: 34–37. 1997 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    9

    Ямамото Ф., Макнил П.Д. и Хакомори С. Геномная организация генов группы гистокрови человека ABO.Гликобиология. 5: 51–58. 1995. Просмотр статьи: Google Scholar: PubMed / NCBI

    10

    О’Киф Д.С. и Добрович А: Быстрый и надежный метод ПЦР для генотипирования группы крови АВО. Hum Mutat. 2: 67–70. 1993. Просмотр статьи: Google Scholar: PubMed / NCBI

    11

    Росс М.Б. и де Аларкон П.: гемолитик. заболевание плода и новорожденного. Neoreviews. 14: e83 – e88. 2013. Просмотр статьи: Google Scholar

    12

    Дэниелс Джи: Группы крови человека: Вступление.Группы крови человека. 3-е издание. Вили-Блэквелл; Оксфорд, Великобритания: стр. 1–10. 2013, Просмотр статьи: Google Scholar

    13

    Се Дж., Куреши А.А., Ли И и Хан Дж.: ABO группа крови и заболеваемость раком кожи. PLoS One. 5: e119722010. Просмотр статьи: Google Scholar: PubMed / NCBI

    14

    Iodice S, Maisonneuve P, Botteri E, Sandri MT и Lowenfels AB: Группа крови ABO и рак.Eur J Cancer. 46: 3345–3350. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    15

    Франкини М, Росси С, Менголи С, Фраттини F, Crestani S, Giacomini I, Luppi M и Bonfanti C: группа крови ABO и риск ишемической болезни сердца. J Thromb Thrombolys. 36: 286–287. 2013. Просмотр статьи: Google Scholar

    16

    Олссон М.Л., Иршайд Н.М., Хоссейни-Мааф Б. Хеллберг А., Плесень М.К., Саренева Х. и Честер М.А.: Геномный анализ. клинических образцов с серологической группой крови по системе АВО расхождения: Идентификация 15 новых аллелей подгрупп A и B.Кровь. 98: 1585–1593. 2001. Просмотр статьи: Google Scholar: PubMed / NCBI

    17

    Страттон Ф., Рентон П.Х. и Хэнкок Дж.А.: Красный на агглютинируемость клеток влияет болезнь. Природа. 181: 62–63. 1958 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    18

    Hoogstraten B, Rosenfield RE и Вассерман LR: Изменение группы крови ABO у больного лейкемией. Переливание. 1: 32–35.1961. Просмотреть статью: Google Scholar: PubMed / NCBI

    19

    Нотоми Т, Окаяма Х, Масубучи Х, Ёнекава T, Watanabe K, Amino N и Hase T: петлевой изотермический амплификация ДНК. Nucleic Acids Res. 28: e632000. Просмотр статьи: Google Scholar: PubMed / NCBI

    20

    Аонума Х, Бадоло А, Окадо К. и Канука Х: Обнаружение мутации аллель-специфической петлевой изотермической амплификация (AS-LAMP).Методы Мол биол. 1039: 121–127. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

    21

    Митани Ю., Лежава А., Кавай Ю., Кикучи Т., Огучи-Катаяма А, Кого Й, Ито М, Мияги Т, Такакура Х, Хоши К., и др.: Быстрая диагностика SNP с использованием асимметричной изотермической усиление и новая технология подавления рассогласования. Нат Методы. 4: 257–262. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

    22

    Парида М, Саннарангаия С, Даш П.К., Рао П.В. и Morita K: Петлевая изотермическая амплификация (LAMP): новый создание инновационной техники амплификации генов; перспективы в клинической диагностике инфекционных заболеваний.Rev Med Virol. 18: 407–421. 2008. Просмотр Статья: Google Scholar: PubMed / NCBI

    23

    Хэ Дж, Ши Икс, Ю Л, Чжэн Х, Лань В, Цзя П, Ван Дж. И Лю Х. Разработка и оценка петлевой изотермический анализ амплификации для диагностики карповых герпесвирус 2. J Virol Methods. 194: 206–210. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

    Генотип: SYNLAB Нигерия

    Зачем мне нужно знать свой генотип крови?

    Основная причина — предотвратить продолжение серповидно-клеточной анемии.Серповидно-клеточная анемия — это наследственное заболевание, при котором эритроциты имеют форму серпа. Это приводит к состоянию, когда эти клетки переносят меньше кислорода и блокируют нормальный поток крови к другим частям тела.

    Болезнь поражает все системы организма, но криз боли в костях является наиболее частым симптомом. Серповидно-клеточная анемия очень распространена в Нигерии; это потому, что многие из нас не знают генотип своей крови.

    Распространенность серповидно-клеточной анемии в Нигерии составляет около 25%, и до тех пор, пока два человека с серповидно-клеточной особенностью вступают в брак, бремя серповидно-клеточной анемии всегда будет увеличиваться.

    Когда я могу проверить свой генотип крови?

    Генотип крови можно проверить в любом возрасте. Тест обычно проводится в рамках добрачного расследования (в Нигерии), но в идеале его следует сдать задолго до этого. Пары, чьи генотипы несовместимы (AS vs SS), могут испытывать сложные отношения, позже сталкиваться с серьезными проблемами или даже испытывать разрыв отношений.

    Как мне проверить свой генотип крови?

    Существуют разные типы тестирования генотипа.

    Некоторые из них являются качественными — эти тесты требуют проведения подтверждающих тестов в зависимости от результата, поскольку результаты могут быть недостаточно четкими. Полагаться исключительно на качественные тесты без подтверждения может быть проблематично, поскольку эти тесты не могут обнаружить многие аномальные варианты гемоглобина и талассемию.

    Лучшим методом тестирования генотипа крови является определение количества гемоглобина с помощью электрофореза в капиллярной зоне или ВЭЖХ. Эти количественные методы являются более полными и дают более широкий спектр нарушений гемоглобина, включая талассемию и другие менее распространенные варианты гемоглобина, такие как гемоглобин C и D и т. Д.Он также определяет HbF (фетальный Hb) и HbA2. Количественные тесты также служат в качестве подтверждающих тестов для других качественных тестов.

    Для количественного определения гемоглобина используется самая точная технология, доступная на сегодняшний день, и он является предпочтительным методом тестирования генотипа крови во всем мире.

    На что указывают результаты анализа генотипа крови?

    Ваши результаты могут отображаться как AA, AS, AC, SS, SC, SD и т. Д.

    Результаты покажут, не страдаете ли вы серповидно-клеточной анемией, носителем или если у вас серповидноклеточная анемия, серповидноклеточная анемия. или другие возможные варианты.

    В прошлом людей с вариантами серповидноклеточной анемии, такими как SC или SD, нельзя было обнаружить с помощью качественного метода. Теперь, используя количественный метод, можно эффективно диагностировать людей.

    Метод количественного определения HB также используется при лечении пациентов с серповидно-клеточной анемией, получающих лечение гидроксимочевиной, путем измерения количества HbF, тем самым предотвращая токсический эффект, который гидроксимочевина может оказывать на организм.

    Генотип младенцев можно определить генетическим (ДНК) методом, пока ребенок еще находится в утробе матери, просто используя кровь матери.Этот тест называется (NIPT) и доступен в SYNLAB.

    Редчайшая группа крови плюс совместимость группы крови и генетика

    Какие группы крови?

    Каждая капля крови содержит эритроциты, которые переносят кислород по всему телу. Он также содержит лейкоциты, которые помогают бороться с инфекцией, и тромбоциты, которые способствуют свертыванию крови.

    Но это еще не все. Ваша кровь также содержит антигены — белки и сахара, которые находятся на красных кровяных тельцах и определяют их тип крови.Хотя существует по крайней мере 33 системы определения группы крови, широко используются только две. Это системы групп крови АВО и резус-положительный / резус-отрицательный. Вместе эти две группы образуют восемь основных групп крови, с которыми знакомо большинство людей:

    • A-положительный
    • A-отрицательный
    • B-положительный
    • B-отрицательный
    • AB-положительный
    • AB-отрицательный
    • О-положительный
    • О-отрицательный

    Продолжайте читать, чтобы узнать больше о группах крови и почему трудно сказать, какой тип является самым редким в мире.

    Группы крови определяются генетически. Вы наследуете гены от своих родителей — один от матери и один от отца — чтобы создать пару.

    Система ABO

    Когда дело доходит до группы крови, вы можете унаследовать антиген A от одного родителя и антиген B от другого, что приведет к группе крови AB. Вы также можете получить антигены B от обоих родителей, что даст вам группу крови BB или B.

    Тип O, напротив, не содержит антигенов и не влияет на группы крови A и B.Это означает, что если вы унаследуете, например, O от своей матери и A от отца, ваша группа крови будет A. Также возможно, что два человека с кровью типа A или B могут иметь ребенка с кровью типа O, если они несут О-антиген. Например, каждый из родителей с AO кровью может передать O-антиген своему ребенку, создавая OO (или просто O) кровь. Всего существует шесть таких комбинаций (AA, AB, BB, AO, BO, OO), которые называются генотипами. Четыре группы крови (A, B, AB и O) происходят от этих генотипов.

    Резус-фактор

    Кровь также типируется по так называемому резус-фактору. Это еще один антиген, обнаруженный в эритроцитах. Если в клетках есть антиген, они считаются резус-положительными. Если его нет, они считаются резус-отрицательными. В зависимости от того, присутствует ли резус-антиген, каждой группе крови присваивается положительный или отрицательный символ.

    Трудно сказать, какая группа крови самая редкая в мире, поскольку они связаны с генетикой. Это означает, что распространенность определенных групп крови сильно различается в разных частях мира.

    Однако в Соединенных Штатах AB-отрицательный считается самой редкой группой крови, а O-положительный — наиболее распространенной. Центр крови Стэнфордской школы медицины ранжирует группы крови в Соединенных Штатах от самых редких к наиболее распространенным следующим образом:

    1. AB-отрицательные (0,6 процента)
    2. B-отрицательные (1,5 процента)
    3. AB-положительные (3,4 процента). )
    4. A-отрицательный (6,3 процента)
    5. O-отрицательный (6,6 процента)
    6. B-положительный (8,5 процента)
    7. A-положительный (35.7 процентов)
    8. О-положительные (37,4 процента)

    Опять же, этот рейтинг не универсален. В Индии, например, наиболее распространена группа крови B-положительная, а в Дании — A-положительная. Эти вариации также существуют в группах американцев. По данным Красного Креста, например, у американцев азиатского происхождения гораздо больше шансов иметь B-положительную группу крови, чем у латиноамериканцев и кавказцев.

    Ваша иммунная система естественным образом содержит защитные вещества, называемые антителами.Они помогают бороться с любым материалом, который ваша иммунная система не распознает. Обычно они атакуют вирусы и бактерии.

    Однако антитела также могут атаковать антигены, которых нет в вашей естественной группе крови. Например, если у вас кровь группы B, смешанная с кровью группы A во время переливания, ваши антитела будут уничтожать антигены A. Это может иметь опасные для жизни результаты, поэтому в медицинских центрах по всему миру действуют строгие процедуры, чтобы этого не произошло.

    Имейте в виду, что группы крови не всегда должны точно совпадать, чтобы быть совместимыми. Например, кровь AB содержит как антиген A, так и антиген B, поэтому человек с этим типом крови может получать кровь либо типа A, либо типа B. Каждый может получить кровь группы O, потому что она не содержит антигенов. Вот почему люди с кровью группы O считаются «универсальными донорами». Однако люди с кровью группы O могут получать только кровь группы O.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *