Дисбактериоз кишечника у новорожденных: Дисбактериоз у детей — причины, симптомы, диагностика и лечение дисбактериоза кишечника у ребенка в Москве в детской клинике «СМ-Доктор»

Содержание

Дисбактериоз кишечника у грудничка: симптомы и лечение

Причины заболевания

Этиологический факторы патологии разнообразны. Причинами дисбактериоза у новорожденных являются:

  • осложненное течение беременности;
  • трудные роды;
  • позднее прикладывание к груди;
  • переход с гв на ив;
  • рождение раньше запланированного срока;
  • бактериальный вагиноз у мамы;
  • плохое питание матери на грудном вскармливании;
  • мастит;
  • частые ОРВИ;
  • диатез.

У детей старшего возраста патология возникает в результате:

  • нерациональное питание;
  • избыток в рационе углеводов, жиров;
  • длительная терапия гормональными, антибактериальными препаратами;
  • антибиотикотерапия;
  • кишечные инфекции;
  • патологии органов пищеварительной системы;
  • глистные инвазии;
  • цирроз печени;
  • онкологические заболевания.

Меньшикова Мария Викторовна

врач акушер-гинеколог

Дисбиоз кишечника у детей не является самостоятельным заболеванием, лежит в основе многих болезней. Наши врачи на дистанционной консультации объяснят, почему появился дисбактериоз у детей, помогут сузить круг причин, ответят на любые вопросы, будут на связи в любое время суток.

Классификация дисбактериоза

Классификация патологии — условна, так как проявлений дисбактериоза, агентов микрофлоры много.

Степени дисбактериоза у детей:

Наименования

Описание

1 степень

Понижение нормофлоры

2 степень

Развитие условно-патогенной микрофлоры

3 степень

Присоединение патогенной микрофлоры

По клинико-бактериологическим критериям:

Наименование

Описание

Компенсированный

Протекает в скрытой форме 1-2 степени тяжести.

Субкомпенсированный

Локально, 2-3 степени тяжести

Декомпенсированный

Генерализованное или локальное течение, 3-4 степени тяжести

Пример 

Родители обратились к гастроэнтерологу с ребенком 7 лет. Жалобы были на частое расстройство пищеварения, выражающееся чередованием запоров и диареи. Ребенка мучает отрыжка. Ест плохо. В массе прибавляет мало. Появились кожные проблемы в виде шелушения на лице. До этого принимали длительно антибиотики при лечении пневмонии. Для постановки диагноза назначено УЗИ брюшной полости, ОАК, бактериологическое, биохимическое исследование кала, копрограмма. На основании исследований, анамнеза и осмотра поставлен диагноз: дисбактериоз кишечника на фоне приема антибиотиков 2 степени. Назначено лечение, диета.

Симптомы дисбактериоза у детей

Дисбактериоз у детей до года проявляется следующими признаками:

  • рвотой;
  • частыми срыгиваниями;
  • вздутием живота;
  • спастическими болями в области кишечника;
  • плохим сном;
  • беспокойством;
  • потерей аппетита;
  • плохим набором веса.

Стул жидкий, с пеной, присутствуют примеси слизи, комочков непереваренной пищи, запах гнилостный, кислый.

При мальабсорбции наблюдается стеаторея, диарея, гипотрофия. Интоксикация сопровождается анемией, снижением аппетита, задержкой физического развития. Из-за процессов брожения, гниения в кишечнику появляются дерматиты, крапивница, сыпь.

У детей постарше дисбактериоз кишечника проявляется:

  • запорами;
  • поносами;
  • чередованием диареи и запоров;
  • кишечными коликами;
  • неприятным запахом изо рта;
  • чувством распирания желудка;
  • заедами в углах рта;
  • стоматиты;
  • сыпь;
  • фурункулез.

Генерализованная форма болезни появляется у детей с иммунодефицитом. Для нее характерно развитие глоссита, хейлита, кандидоза, баланопостита, вульвита.

Меньшикова Мария Викторовна

врач акушер-гинеколог

На фоне дисбиоза могут развиваться и другие симптомы, характерные для различных заболеваний. Если вы сомневаетесь в наличии дисбактериоза у ребенка, свяжитесь с нашими врачами. Они на дистанционной консультации объяснят клиническую картину дисбактериоза, расскажут о возможных связанных патологиях, посоветуют клиники для обследования, дадут перечень необходимых анализов.

Диагностика патологии

Для постановки диагноза необходимо:

  • сделать копрограмму — даст понять степень переваривания еды;
  • посев кала на условно-патогенную флору — покажет процент облигатных бактерий.

Для установки причины заболевания может назначаться УЗИ-диагностика органов брюшной полости, гастроскопия, анализ кала на лямблии, яйца гельминтов.

Дифференциальная диагностика у младенцев исключает:

  • дисахаридазную первичную лактазную недостаточность;
  • глютеновую энтеропатию;
  • синдром мальабсорбции;
  • ОКИ;
  • неспецифический язвенный колит;
  • муковисцидоз.

Осложнения дисбактериоза

В кишечнике нарушается всасываемость питательных веществ. В результате ребенок отстает в развитии. Так как кишечник раздражается продуктами не полностью переваренной пищи, появляется вздутие, одышка, тахикардия, колит. Часто патогенная микрофлора переходит на тонкий кишечник, в котором начинается процесс воспаления. В этом случае пищеварение и всасывание нарушается полностью.

Лечение заболевания

Лечение патологии начинается с составления диеты. Дети, находящиеся на смешанном питании получают кисломолочные продукты. Детям старшего возраста ограничиваются в рационе углеводы, сахар, животные белки. Чтобы восстановить микрофлору кишечника важно употреблять кисломолочные продукты с бифидобактериями, пищевые волокна. Врачи при дисбактериозе назначают про- и пребиотики, симбиотики, бактериофаги. В крайних случаях назначаются антибиотики. Если дисбактериоз вызван грибками рода кандида, то показаны противогрибковые препараты.

Важно! При выраженных нарушениях пищеварения необходим прием ферментов, сорбентов. При рецидивирующем дисбактериозе необходимо включать иммуномодулирующие лекарственные средства, витамины.

Профилактика дисбактериоза у детей

Профилактические меры начинаются с момента беременности:

  • будущая мама должна тщательно следить за полноценным питанием и своим рационом;
  • беременная должна своевременно выявлять заболевания и лечить их;
  • своевременное прикладывание к груди младенца;
  • грамотный подход к подбору смеси, если ребенок на искусственном вскармливании;
  • введение прикорма по правилам.

Частые вопросы

Какие анализы надо сдать на дисбактериоз у грудничка?

+

У грудничка необходимо собрать кал на анализ. Определяется наличие паразитов, примесей, патогенная и нормальная микрофлора. Анализ кала на дисбактериоз не информативен.

Что показывают микробиологические исследования кала при дисбактериозе?

+

Культуральный и бактериологический методы укажут на наличие условно-патогенных, патогенных и полезных бактерий.

С какого месяца можно принимать пребиотики в лекарственной форме младенцу?

+

Новорожденные получают все необходимые вещества через материнское молоко. Дети на искусственном вскармливании- через смеси. В возрасте 6 месяцев рацион малыша обогащается продуктами, содержащими про-, пребиотики, бифидобактерии. Лекарственные формы даются детям только по предписанию врача.

Почему возникает дисбактериоз у годовалого ребенка?

+

Сам по себе дисбактериоз не возникает. Чаще всего — следствие или осложнение болезни. Важно установить причину патологии. Часто в детском возрасте причинами могут стать стрессы, несбалансированный рацион, соматические болезни, антибиотики.

Заключение эксперта

Дисбактериоз характеризуется нарушением нормальной микрофлоры кишечника. Проявляется диспептическими расстройствами. Детей старших возрастов патология имеет клинические признаки гастрита, энтерита, энтероколита. Поэтому врачи проводят диагностические исследования, чтобы выявить причину патологии. При дисбактериозе необходимо в первую очередь соблюдать диету, назначенную врачом. прием препаратов только под контролем специалистов.

Питание грудничка при дисбактериозе — Статьи о детском питании от педиатров и экспертов МАМАКО

Как улучшить здоровье кишечника новорожденного и вылечить дисбактериоз у грудничка с помощью детского питания? Решаем проблему дисбактериоза: обсуждаем его признаки, медицинские анализы, лечение, питание и многое другое с кандидатом медицинских наук, врачом высшей категории, врачом-педиатром и заместителем заведующей детским центром «Мать и Дитя» на Савеловской Аллой Анатольевной Щербаковой.

— Алла Анатольевна, что входит в понятие «дисбактериоз у грудничка»?

— Дисбактериоз — иностранное слово, означающее нарушение в составе бактерий. В нашем конкретном случае дисбактериоз рассматривается как нарушение в кишечнике, потому что бывает дисбактериоз кожи, дисбактериоз дыхательных путей и даже дисбактериоз крови.

Дисбактериоз кишечника у грудничка — нарушение микробиоты, состава микроскопических обитателей желудочно-кишечного тракта.

Понятие дисбактериоза существует, но в международной классификации болезней такого диагноза нет, как нет и нормы содержания микробиоты кишечника у ребенка первого года жизни. Поэтому изменения микробиоты, которые выдает лаборатория в результатах медицинских анализов, могут быть вариантом нормы, но также и проявлением кишечной инфекции, и состоянием после назначения антибиотиков или пробиотиков. У детей диагноза «дисбактериоз» быть не может.

 

— Почему у новорожденных возникают проблемы с пищеварением и сколько длится дисбактериоз у ребенка?

— При рождении ребенок переходит от питания через плаценту на энтеральное питание грудным молоком или молочной смесью. С началом молочного вскармливания в кишечнике идет чужеродный воспалительный процесс, который сопровождается формированием микробиоты — «хорошей» (бифидобактерии, лактобактерии) и условно-патогенной (стафилококки, клебсиеллы, энтерококки и др.). Условно-патогенные микробы могут вызывать бродильные процессы, которые при искусственном и естественном вскармливании считаются нормой. Поэтому лечение условно-патогенной микрофлоры в 99 % случаев не требуется. Естественный процесс закончится к трем месяцам, это и есть колики, которые сопровождают так называемый дисбактериоз.

— Признаки дисбактериоза у грудничков часто сбивают с толку родителей?

— У новорожденных и малышей нередко возникают проблемы с желудочно-кишечным трактом — это недостаточная прибавка веса, срыгивания, запоры, поносы, изменения характера и цвета стула и другие. И в этих ситуациях родители зачастую делают анализ кала грудничка на дисбактериоз. А увидев в полученных результатах отличия от представленных норм, начинают нервничать и приходят на прием. Но выполненное исследование будет необоснованным и неинформативным, педиатр не примет его во внимание.

 

— Если анализ кала на дисбактериоз у грудничка не имеет диагностического значения, как тогда диагностируют нарушения работы органов пищеварительной системы у ребенка до года?

— Сегодня педиатры анализ на дисбактериоз не назначают. Норм содержания микробов в микробиоте и дисбактериоза у детей первого года жизни нет. Исследование неинформативно, и изменение микробиоты, которое показывают результаты, не требует никакого лечения и рекомендаций.

Температура, рвота, понос, жидкий стул, боли в животе у ребенка могут быть проявлениями кишечной инфекции. Любые жалобы ребенка требуют предварительного осмотра врачом. При подозрении на инфекционное заболевание назначается анализ кала на кишечную группу — исследование на энтеровирусы, ротавирусы, норовирусы, которое имеет диагностический и лечебный смысл.

— Дисбактериоз и аллергическая реакция у детей как-то связаны? Нужно ли лечить дисбактериоз у грудничка с пищевой аллергией?

— Жалобы на недостаточную прибавку веса, срыгивания, запоры, изменения характера стула, слизь и кровь в стуле, стафилококки и клебсиеллы в кале анализа на дисбактериоз — чаще всего такие нарушения микробиоты кишечника маленького ребенка будут вторичным процессом на фоне пищевой аллергии. При пищевой непереносимости требуется назначать ребенку лечебное питание, а не бороться с дисбактериозом. С жалобами нужно обратиться к врачу-гастроэнтерологу, который ведет педиатрический прием.

— Алла Анатольевна, возможна ли профилактика дисбактериоза у грудничка — например, нужно ли новорожденному давать пробиотики и пребиотики?

— Искусственная молочная смесь стерильна, если в нее не добавлены пробиотики. Грудное молоко содержит не только пребиотики и пробиотики, но и другие живые составляющие, которые влияют на микробиоту ребенка и содержимое его кишечника. И это хорошее проявление взаимодействия мамы и ребенка. Проведенные исследования показали, что микробиота грудного молока превращается в микробиоту кишечника малыша и в дальнейшем сопровождается развитием детского иммунитета, способствует лучшему усвоению питательных элементов, а значит, росту и развитию ребенка.

Пробиотики, которые назначаются маленьким детям, могут быть небезопасны. Все терапевтические решения лучше согласовывать со своим врачом. Назначать пробиотики для решения уже существующей желудочно-кишечной проблемы не имеет смысла, потому что сначала нужно подобрать питание — и дисбактериоз пройдет сам собой.




Читайте также об особенностях пищеварительной системы грудничков и о том, как наладить пищеварение новорожденного


 

— Чем лечить дисбактериоз у ребенка и какое значение имеет питание при дисбактериозе грудничка?

— Лечение дисбактериоза у грудничка — это именно изменение питания, лечение бактериофагами не назначается. Когда ребенку-искусственнику правильно подобрана сухая молочная смесь или кормящей грудью маме назначено питание, дисбактериоза у малыша быть не должно.

Если жалобы у малыша только на колики, может быть назначена смесь на козьем молоке МАМАКО®. Смеси на козьем молоке среди других молочных смесей наиболее приближены к маминому грудному молоку по белковому профилю. MAMAKO® Premium не содержит пальмового масла, которого боятся многие мамы. Питание создано для вскармливания здоровых младенцев, профилактики колик и других проблем со стороны органов пищеварения.

— При смене искусственной смеси как быстро будут видны результаты и по каким признакам понять, что проблема пошла на спад?

— При смене детской смеси первые изменения состояния ребенка могут быть видны через 5—7 дней. Например, если у малыша наблюдаются колики, вздутия, метеоризм, боли во время питания, в его стуле появляются слизь, кровь, непереваренные кусочки, творожистые сгустки, то при положительной динамике на новом питании ему станет лучше. Очевидные изменения в состоянии здоровья педиатры обещают родителям через 2—4 недели, когда абсолютно точно должен быть результат и благоприятные перемены. Один месяц — срок, когда можно сказать, поменялось ли состояние желудочно-кишечного тракта, изменился ли стул ребенка, есть ли положительная динамика.

 

— Почему козья смесь подходит не всем детям?

— Смесь на козьем молоке — это продукт для здоровых детей и комфортного пищеварения. Если малыш недоношенный и родился с маленьким весом, то для него приоритетнее смесь с маркировкой ПРЕ с повышенным содержанием белка, которое соответствует молозиву.

Сыпь, сухость, покраснения, зуд кожи или срыгивания, недостаточная прибавка веса, поносы, слизь и кровь в стуле, повышенные значения лейкоцитов и эритроцитов в копрограмме, положительная реакция на белок и скрытую кровь в кале — все это признаки кожной и гастроинтестинальной форм аллергии на пищу, при которой назначают специальные лечебные смеси на основе гидролизатов или аминокислот.

Дисбактериоз в переводе означает нарушение микробиоты, но такого заболевания в международной классификации болезней нет. Проблемы у ребенка со стороны желудочно-кишечного тракта — всегда повод для обращения к врачу, изменения питания и назначения специализированного лечения.

Врач-педиатр
Алла Анатольевна Щербакова

*Идеальным питанием для грудного ребенка является молоко матери. ВОЗ рекомендует исключительно грудное вскармливание в первые 6 мес. МАМАКО® поддерживает данную рекомендацию. Перед введением в рацион малыша новых продуктов проконсультируйтесь со специалистом.

27-mini лекция «Особенности формирования микробиоценоза у грудных детей и дисбактериоз кишечника»

В настоящее время не подвергается сомнению, что мать является первичным источником колонизации, а иногда и инфицирования своего ребенка.

В современных условиях характер первичной микробной колонизации претерпел критические изменения, что связано с увеличением контингента женщин с перинатальными факторами риска, с обусловленным этим осложненным течением беременности (гестозы, угроза прерывания беременности) и нарушением микроэкологического статуса, а также с неполноценностью питания, возрастанием стрессовых воздействий, экологическим неблагополучием и бесконтрольным применением антибиотиков.

Принципиальным является признанный факт – заселение различными микроорганизмами основных экологических ниш новорожденного ребенка начинается автоматически с момента прохождения его через родовые пути матери. Между тем появилась и другая точка зрения, основанная на результатах экспериментальных работ.

Из недавно опубликованных данных следует, что нормальная микрофлора кишечника у плода закладывается во второй половине беременности от матери при помощи феномена бактериальной транслокации.

Состояние микробиоценоза основных локусов у новорожденных на сегодняшний день рассматривается как достаточно информативный маркер, отражающий систему адаптационных процессов. С этих позиций чрезвычайно остро встает вопрос оценки функциональных взаимоотношений в системе «мать–плод–новорожденный».

Сегодня убедительно доказано, что естественная микрофлора кишечника у женщин в период беременности по сравнению с микрофлорой других биотопов играет главенствующую

физиологическую роль в формировании и динамике становления микрофлоры кишечника у новорожденных детей.

Учитывая данный факт, подтвержденный в ходе ряда исследований, отработаны практические рекомендации на этапе дородовой подготовки: проведение бактериологического скрининга среди беременных женщин с определением качественного и количественного состава не только влагалища, но и кишечника.

Обязательному бактериологическому обследованию должны подлежать пациентки, имеющие хронические инфекционно-воспалительные заболевания урогенитального тракта (пиелонефрит, воспалительные заболевания придатков матки), болезни органов пищеварения (гастрит, холецистит и др.), сочетание хронической патологии и острых инфекционных заболеваний, а также получавших местную или общую антибактериальную терапию во время настоящей беременности.

При наличии изменений в видовом и численном составе микрофлоры коррекция биоценоза кишечника должна проводиться с помощью пробиотиков и продуктов функционального питания. По нашим данным, восстановление микробиоценоза толстой кишки является специфическим маркером нормализации биоценозов в остальных микробиотопах.

В последние годы внимание исследователей все чаще привлекают вопросы, связанные со значением микрофлоры матери в осуществлении естественной динамики развития иммунитета у новорожденного ребенка. Основываясь на экспериментальных исследованиях, было высказано предположение о том, что в организме беременной женщины постоянно происходит спонтанная или индуцированная различными факторами гибель микроорганизмов, что сопровождается высвобождением соответствующих антигенов и их сорбцией.

Трансплацентарное проникновение микробных антигенов ведет к их поступлению в вилочковую железу плода и образованию в ней предшественников Т-супрессорных клеток. В процессе внутриутробного развития антигенная доза становится все больше, накапливаются клетки-предшественники, которые вскоре после рождения мигрируют из тимуса в ассоциированную с пищеварительным трактом лимфоидную ткань.

Здесь, взаимодействуя с антигенами первых попавших в организм новорожденного микроорганизмов, они дифференцируются в Т-супрессорные клетки, обеспечивающие толерантность к тем микроорганизмам, которые в максимальной степени индуцировали у плода формирование клеток-предшественников.

С помощью совершенствования техники кордоцентеза установлены новые данные, которые позволяют оценить возможности иммунной системы плода антенатального периода жизни в реагировании на антигенные раздражители и развитии иммунитета у детей. Получены достаточно отчетливые признаки поляризации иммунного ответа плодов по пути Th3 от женщин, страдающих атопией.

Это коррелировало с высокой частотой и ранними сроками появления аллергической патологии в первые месяцы жизни у таких детей. В группе плодов, развивающихся у беременных, инфицированных цитомегаловирусом, выявлено явное реагирование Т-лимфоцитов по пути Th2.

Память иммунной системы на микробные агенты, попадающие в плод от матери через плаценту, сохраняется и во взрослом организме. Это положение требует внимания педиатров-интернистов, им необходимо учитывать его для предотвращения развития негативных иммунологических реакций к пищевым антигенам или формирования врожденной сниженной колонизационной резистентности у новорожденных (часто возникающей после антибиотикотерапии беременных женщин).

Таким образом, плацентацию и длительное эмбриональное развитие в утробе матери необходимо рассматривать как ценнейший эволюционно приобретенный механизм длительной адаптации плода и его иммунологического аппарата к микрофлоре матери и семьи, с которой он встретится после рождения, что объясняет целесообразность совместного пребывания матери и ребенка в одной палате родильного дома.

Заселение ЖКТ после рождения происходит в рострально-каудальном направлении. Формированию нормальной микрофлоры кишечника новорожденного ребенка способствует раннее, в течение получаса после рождения, прикладывание к груди.

Вопрос задает – Ирина, — вопрос-ответ от специалистов клиники «Мать и дитя»

23.10.2014

Здравствуйте !!!Моему сыночку 4,5 мес.После приезда домой из роддома на 4й день перестал сам какать вообще.Пропили линекс курс 7 дней.Пили дюфалак.Бифилиз тоже пропили.Улучшений нет.Сдали анализ на дисбактериоз-показал гемолизирующая кишечная палочка 90%,кишечная палочка со сниженной ферментативной активностью 20%.Остальное в норме.Врач сказал,что у нас все в порядке,лечится не надо,а когда я описала поведение ребенка-решила,что надо.Кал в конце пенистый,выгинается,временами кричит.Назначила колипротейный бактерифаг 2р в день 5-7 дн,саб симплекс,прелакс или нормазе 5мл 1р в дн+вечером 2,5 мл добавочно.Прошли УЗИ всех органов,все нормально.Хотелось бы узнать ваше мнение.Буду очень благодарна Вам!!!

Клиника «Мать и дитя» Кунцево:

26.01.2021

Здравствуйте! Дисбактериоз — это нарушение нормального соотношения микроорганизмов в кишечнике человека.  Дисбактериоз, у детей первых месяцев жизни — это не заболевание, а состояние, вызванное изменением микромира кишечника или его несформированностью. Появившись на свет, ребенок попадает из абсолютно стерильной среды материнского организма в мир, заселенный огромным количеством разнообразных микробов. Он не может оставаться стерильным долгое время. Практически сразу после рождения его организм начинает заселяться представителями микробного мира. Кишечник ребенка частично заселяется микробами еще в процессе родов, когда малыш продвигается по родовым путям матери. В первые минуты жизни младенцев укладывают маме на живот — ее кожа отдает часть своей микрофлоры, защищая ребенка от первичного заселения чужими микробами. Но еще более важно первое прикладывание к груди. Заселение  кишечника микроорганизмами происходит неорганизованно, спонтанно. Должно пройти некоторое время, прежде чем количество и состав этих микробов упорядочится так, чтобы хорошо выполнять свои функции в организме растущего человека. Состав первичной бактериальной флоры кишечника, слизистых оболочек и кожи новорожденного далек от нормального. Можно сказать, что сразу после рождения ребенок приобретает дисбактериоз, который называется транзиторным, то есть переходным. Это состояние свойственно всем новорожденным. В целом интенсивное заселение кишечника продолжается до 3-4 недели жизни ребенка. Конечно, в дальнейшем картина еще будет меняться по мере роста ребенка, изменения его питания, образа жизни и только к 12-месячному возрасту (по самым современным данным — к двум (!) годам) состав и количество микроорганизмов приближается к таковому у взрослых людей. Младенец, в кишечнике которого нарушен количественный и качественный состав микрофлоры, зачастую ведет себя беспокойно, у него нарушается сон из-за болезненных спазмов кишечника, которые носят приступообразный характер и проявляются через 1,5-2 ч. после кормления. Практически всегда это сопровождается вздутием живота вследствие усиленного газообразования, урчанием по ходу кишечника. У многих малышей на фоне дисбактериоза развиваются упорные запоры, поскольку при отсутствии нормального числа бифидобактерий не вырабатывается в должном количестве вещество, стимулирующее сократительную активность кишечника. Коррекция дисбактериоза заключается, прежде всего, в устранении его причины. Этим вопросом занимается педиатр, гастроэнтеролог, аллерголог или инфекционист, в зависимости от характера основной причины. В ходе устранения основной причины одновременно уменьшаются проявления дисбиоза. Например, при нормализации стула у ребёнка или коррекции ферментативных нарушений происходит улучшение микробиологического пейзажа кишечника. В целом, в любом случае коррекция микробиологических нарушений должна проводиться врачом с учетом всех нюансов состояния малыша — его возраста, характера вскармливания, пищевой переносимости, характера микробного пейзажа, специфики основной причины. Консультант: врач-педиатр высшей категории, кандидат медицинских наук, зам. главного врача Полякова О.В. 

Энтерожермина | Еженедельник АПТЕКА

Наверное, у многих работников первого стола слово «дисбиоз» в первую очередь ассоциируется со взрослыми людьми, однако необходимо помнить, что формирование микрофлоры кишечника начинается с первых дней жизни человека и нарушение этого процесса — весьма актуальная проблема у детей раннего возраста. Как происходит формирование микрофлоры кишечника у ребенка, какие проблемы может нести нарушение этого процесса, и, самое главное, как помочь ребенку с дисбиозом? Ответы на эти вопросы вы узнаете, прочитав эту публикацию.

У новорожденных становление биоценоза кишечника проходит в 3 стадии. Первая из них — асептическая — развивается в первые часы после рождения и происходит за счет флоры родовых путей. Вторая — возрастающей обсемененности микрофлорой — продолжается первые 3 дня жизни. В этот период, который зависит от времени прикладывания к груди, характера вскармливания, степени зрелости, эпидемиологического окружения, может отмечаться дисбаланс между различными представителями микрофлоры, получивший название «физиологический дисбиоз». Как правило, к концу 1-го месяца жизни наступает третья фаза — трансформации флоры кишечника. В этот период устанавливается нормальная микрофлора.

Однако транзиторный дисбактериоз может затянуться и принять более опасные формы. Произойти это может потому, что полезные бактерии еще не успели вытеснить из кишечника ребенка болезнетворные микроорганизмы, а несформировавшаяся микрофлора пока не в состоянии подавить активность вредоносных бактерий.

От формирования правильного биоценоза кишечника во многом зависит здоровье ребенка на многие годы вперед. Так, по данным исследований, у 92–94% детей, часто страдающих респираторно-вирусными заболеваниями, имеет место дисбактериоз кишечника I–II степени (Холодова И.Н., Ильенко Л.И., 2006).

Успех коррекции дисбактериоза кишечника напрямую зависит от того, насколько эффективно будут элиминированы чужеродные патогенные микроорганизмы из кишечника. С этой целью можно применять бактериофаги или кишечные антисептики. Однако более физиологическим следует считать использование непатогенных спорообразующих бактерий с пробиотическими свойствами, например штамма Bacillus clausii, обладающего природной способностью подавлять рост чуждых для кишечника человека микроорганизмов. Учитывая эти свойства, такие штаммы специалисты предлагают называть биоэнтеросептиками.

ЭНТЕРОЖЕРМИНА — биоэнтеросептик на основе спорообразующих штаммов Bacillus clausii, устойчивых к воздействию желудочного сока и желчных кислот, что обеспечивает их доставку в кишечник, где они из спор трансформируются в вегетативные формы. Это важно, поскольку клинико-экспериментальные исследования показали, что под воздействием желудочного сока и желчи пробиотики теряют до 90% своей активности до момента попадания в кишечник (Хавкин А.И., Жихарева Н.С., 2006). В пищеварительном тракте Bacillus clausii живут не более 30 дней, после чего выводятся естественным путем, поэтому их называют самоэлиминирующимися антагонистами.

ЭНТЕРОЖЕРМИНА — это лекарственное средство, которое прекрасно подходит для применения у детей раннего возраста. Механизм его действия, основанный на подавлении патогенной микрофлоры и способствующий формированию естественного биоценоза позволяет формировать микрофлору кишечника ребенка на основе полезных штаммов, которые он получил от матери при рождении и кормлении грудью. Кроме того, ЭНТЕРОЖЕРМИНА — это пероральная суспензия без вкуса, цвета и запаха, что делает удобным ее применение у детей.

ЭНТЕРОЖЕРМИНА — это простой и надежный способ справиться с дисбактериозом и диареей. ЭНТЕРОЖЕРМИНУ с успехом применяют для лечения и профилактики дисбактериоза кишечника любой этиологии у взрослых и детей с первых дней жизни. Важно, что применение этого препарата показано во время антибиотикотерапии, поскольку штаммы Bacillus clausii являются антибиотикорезистентными.

Пресс-служба «Еженедельника АПТЕКА»

Дисбактериоз кишечника у грудничка: симптомы и терапия

По словам специалистов, все дети появляются на свет с абсолютно «стерильным» кишечником. Однако в момент прохождения по родовым путям, туда заселяются микроорганизмы. С течением времени у крохи могут появиться неприятные ощущения и дискомфорт в этом органе. Так, очень часто врачи уже в первые недели жизни диагностируют дисбактериоз кишечника у грудничка. Каковы основные его причины? Каким должно быть лечение? Именно об этом мы и расскажем в данной статье.

Первоочередные причины

По словам специалистов, дисбактериоз кишечника у грудничка может появиться по нескольким причинам, среди которых: прием лекарственных препаратов, неправильное питание, а также некоторые болезни органов пищеварения. Заметим, что лечение может начаться и действительно принести пользу только в том случае, если врачу удастся определить первоочередной фактор, вызвавший недуг.

Дисбактериоз кишечника. Симптомы у грудничков

Практически всегда у маленьких пациентов при данном диагнозе появляются следующие симптомы: нарушение стула, высыпания на коже, дискомфорт и боли в зоне живота, пищевая аллергия. Дисбактериоз кишечника у грудничка, как утверждают врачи, чаще всего начинается с жидкого стула с белыми пенистыми комочками. Малыша постоянно тошнит, не прекращается урчание в животе, он часто срыгивает. У ослабленных детей (родившихся недоношенными) данное заболевание нередко сопровождается анемией и развитием молочницы исключительно в ротовой полости.

Диагностика дисбактериоза кишечника у маленьких детей

В первую очередь необходимо отметить, что при появлении первичных симптомов, описанных выше, родители должны в обязательном порядке обратиться к врачу. Вероятнее всего, он назначит ряд анализов, после которых диагноз подтвердится. Заметим, что лабораторный анализ далеко не всегда способен в действительности показать состояние кишечника. Все дело в том, что микрофлора каждого отдельного человека весьма индивидуальна и одновременно переменчива. Кроме того, данное обследование чаще всего не затрагивает саму тонкую кишку, изменения в которой, безусловно, также влияют на общее состояние непосредственно пищеварительной системы. Именно поэтому в некоторых случаях требуются дополнительные анализы (к примеру, крови, мочи), консультация гастроэнтеролога (а также так называемая гастроскопия).

Лечение

По словам специалистов, лечение такого заболевания, как дисбактериоз кишечника у грудничка, должно осуществляться в два этапа. Так, первый подразумевает под собой подавление роста условно патогенных организмов. Здесь, как правило, используются иммунопрепараты, которые отличаются способностью поглощать и одновременно растворять микробные клетки. На втором этапе уже проводится коррекция всего микробного пейзажа кишечника. Данный шаг преследует исключительно одну цель — заселения кишечника так называемой здоровой флорой. При таком лечении используются различного рода пробиотики (лекарственные препараты, которые имеют в своем составе живые бактерии), а также пребиотики (средства с неперевариваемыми веществами для восстановления микрофлоры). Выбор того или иного препарата целиком зависит от индивидуальных показателей здоровья ребенка.

Дисбактериоз у детей: лечим правильно!

На следующей стадии дисбактериоза, когда в микрофлоре уже появляются патогенные бактерии, проявлений значительно больше. Они могут быть похожи на симптомы различных заболеваний.

У грудных детей наблюдаются срыгивания, рвота, вздутие живота, через 1,5-2 часа после еды малыш беспокоится, притягивает ножки к животу, у него нарушается сон, он плохо прибавляет в весе.

У детей постарше могут наблюдаться признаки гастрита (воспаления желудка). После приема пищи появляется чувство распирания или боли в животе; снижается, а иногда и совсем пропадает аппетит; часто случается изжога, может появиться отрыжка, тошнота и даже рвота; периодически болит верхняя часть живота; постоянны усиленное газообразование и запоры.

Дисбактериоз может проявляться симптомами энтерита (воспаления тонкого кишечника), а именно частыми поносами, вздутием живота, метеоризмом, болями в животе. Ребенок становится раздражительным, но в то же время слабым, вялым, он быстро устает, жалуется на головную боль. Стул при этом жидкий, может быть пенистым, с кислым запахом, со слизью и зеленью.

В некоторых случаях дисбактериоз имеет все признаки энтероколита. Ребенок плохо растет, но зато энергично прибавляет в весе, жалуется на схваткообразные боли в животе, у него скопление газов, которые отходят с большим трудом, стул неустойчив: у одних детей частые поносы, у других — запоры.

Дети теряют интерес к пище, даже самые любимые в прошлом продукты им уже не по вкусу. Поскольку нарушаются всасывательные функции кишечника, наблюдается симптом проскальзывания пищи (только поел и уже просится на горшок), появляются сбои в обменных процессах. Дети вялы, им явно не хватает витаминов и минеральных веществ.

Порой дисбактериоз своими симптомами напоминает колит (воспаление толстого кишечника). У ребенка неустойчивый стул: то поносы, то запоры. Практически всегда присутствует синдром неполного опорожнения кишечника: после туалета малыш беспокоен, нервничает, не может объяснить, что его тревожит. Язык обложен налетом, скапливаются газы.

Дисбактериоз материнской и неонатальной микробиоты, связанный с гестационным сахарным диабетом

Введение

В организме человека обитает множество микробов, которые образуют устойчивые симбиотические отношения с хозяином и незаменимы для здоровья человека. С дисбалансом микробиоты человека связан длинный список заболеваний1. В последние годы большое внимание уделяется микробиоте во время беременности и в раннем возрасте, поскольку она очень важна для репродуктивного здоровья.2 Например, существует сильная корреляция между микробиотой влагалища матери и преждевременными родами.3 Кроме того, микробиота матери и новорожденного может влиять на раннее развитие новорожденных4 и может вызывать долгосрочные физиологические последствия в будущем.5 Соответственно, следует приложить усилия, чтобы понять влияние состояния здоровья матери во время беременности на исходную микробиоту новорожденных и материнский вклад.

Гестационный сахарный диабет (ГСД) — это заболевание, связанное с нарушением толерантности к глюкозе, которое впервые возникает и распознается во время беременности.Пероральный тест на толерантность к глюкозе (ОГТТ), проводимый между 24 и 28 неделями, является золотым стандартом для диагностики этого заболевания. ГСД продолжает увеличиваться, что создает большую угрозу здоровью матери и новорожденного. Это было связано с рядом неблагоприятных исходов, включая гестационную гипертензию, сердечно-сосудистые заболевания и преэклампсию у беременных женщин,8 а также макросомию плода, респираторный дистресс-синдром и диабет 2 типа у потомства.9 Более того, диабет у матери может вызвать дисбактериоз микробиоты в меконии новорожденных. постнатальное получение.11 Тем не менее, такие типы образцов, как аспираты из глотки, которые расположены глубоко в организме новорожденного и могут быть собраны сразу после рождения, являются идеальным материалом для изучения влияния ГСД на начальную микробиоту.

В этом исследовании мы выполнили секвенирование гена 16S рРНК и метагеномное секвенирование образцов, взятых из нескольких участков тела 486 беременных китайских женщин и новорожденных в течение нескольких секунд после родов. Наличие или отсутствие ГСД было включено для определения вариаций материнской и неонатальной микробиоты, соответствующих состоянию здоровья беременных женщин, а также для иллюстрации основных микробных дифференциаций в раннем возрасте и их влияния на исходы для здоровья.

Материалы и методы

Набор субъектов

Беременные женщины и новорожденные были набраны в Пекинском авиационном госпитале общего профиля и Народном госпитале Вэньчжоу.Беременные с ГСД (ГСД+) диагностировались врачами-специалистами по результатам ОГТТ и включались в группу наблюдения. Контрольной группой служили здоровые беременные женщины (ГСД-), не имевшие в анамнезе других заболеваний, особенно пародонтита, сахарного диабета 2 типа и бактериального вагиноза.

Сбор проб

Операции по отбору проб проводились обученными специалистами в строгих асептических условиях и по единому протоколу. Амниотическую жидкость (5–10 мл на образец) собирали во время родов.Около 0,5–1 мл слюны новорожденного и 2–3 мл аспирата из зева были взяты стерильными пипетками в течение 60 с после родов до перерезания пуповины. Приблизительно 1 г мекония было взято стерильной пластиковой ложкой в ​​течение 24 часов, как только у новорожденных отошли первые кишечные выделения. Большинство неонатальных образцов было собрано у новорожденных, родоразрешенных путем кесарева сечения. Свежую слюну, кал и вагинальный секрет брали у беременных за 1–2 дня до родов. Вагинальные образцы были собраны из заднего свода под прямой визуализацией с использованием трех тампонов.Все образцы помещали в стерильные пробирки или флаконы, сразу же после сбора замораживали при –20°C, а затем транспортировали в лабораторию и хранили при –80°C до выделения тотальной ДНК для последующего секвенирования.

Подготовка ДНК

На строго контролируемом, отдельном и стерильном рабочем месте приблизительно 0,2 мл образцов слюны, аспирата из глотки и амниотической жидкости смешивали с равными объемами PBS и AL-буфера Qiagen с помощью импульсного вортексирования в течение 30 с. Тотальную ДНК экстрагировали в трех повторностях из суспензии каждого типа образцов с использованием мини-набора QIAamp DNA (Qiagen, Valencia, CA).Образцы фекалий (~200 мг) ресуспендировали в ASL-буфере Qiagen и гомогенизировали в течение 2 мин. Тотальную фекальную ДНК экстрагировали из супернатанта с использованием мини-набора QIAamp DNA Stool Mini Kit (Qiagen). Два вагинальных мазка энергично встряхивали в 0,5 мл PBS и 0,5 мл AL-буфера Qiagen в течение 2 минут для ресуспендирования и лизиса микробных клеток. Полученный лизат обрабатывали с использованием набора QIAamp DNA Mini Kit (Qiagen). Выделенную ДНК элюировали 50 мкл дистиллированной воды. Качество ДНК и концентрацию каждого образца измеряли с помощью электрофореза в агарозном геле и Qubit 3.0 (Life Technologies, Waltham, MA) и перед последующей обработкой.

Высокопроизводительное секвенирование

Для каждого образца мы амплифицировали вариабельные области 3 и 4 (V3-V4) гена 16S рРНК с использованием модифицированных праймеров 341F и 805R. Очищенные положительные ампликоны с различными индексными последовательностями объединяли в эквимолярных количествах, а затем секвенировали на платформе HiSeq2500 (Illumina, Сан-Диего, Калифорния) с реагентами v2 и картриджем 2×250 bp. Метагеномная ДНК 50 образцов мекония (~0,0005 мкг на образец) разрезали на фрагменты ~300 bp с помощью сфокусированного ультразвукового аппарата (Covaris, Woburn, MA). Библиотеки для секвенирования конструировали из разрезанных фрагментов с использованием набора для подготовки образцов TruSeq v2 (Illumina). Длину вставки и целостность библиотек оценивали с помощью анализатора фрагментов (Advanced Analytical Technologies) перед секвенированием парных концов (PE) (2×125 пар оснований) на платформе HiSeq2500.

Анализ последовательности 16S рРНК

Необработанные считывания последовательностей генов 16S рРНК были отфильтрованы по качеству и проанализированы с использованием QIIME V.1.8.0.12 Рабочие таксономические единицы (OTU) были таксономически классифицированы с использованием справочной базы данных генов 16S рРНК Greengenes.13 Таксономический состав микробных сообществ был визуализирован с помощью Calypso.14 Кластеризация сообществ измерялась с помощью невзвешенного расстояния UniFrac на основе нормализованной таблицы OTU. Вместе с набором данных о микробиоте кожи новорожденных, полученным в ходе недавнего исследования,15 расхождение Брея-Кертиса между различными типами образцов было рассчитано с использованием пакета R ecodist.Наборы микробных данных взрослого человека, включая 121 переднюю часть носа, 312 образцов слизистой оболочки щеки, 73 образца средней части влагалища, 102 образца слюны и 55 образцов стула, были загружены из проекта микробиома человека (HMP). Кластерный анализ структуры бактериального сообщества проводили на уровне рода.

Частичный дискриминантный анализ наименьших квадратов и линейный дискриминантный анализ

Частичный дискриминантный анализ наименьших квадратов (PLS-DA) и линейный дискриминантный анализ (LDA) использовались для выявления таксономических и функциональных изменений в материнской и неонатальной микробиоте в ответ на ГСД.16 17 PLS-DA выполняли с помощью R-пакета mixOmics (http://www.mixOmics.org). Дискриминационная способность каждого таксона была количественно определена с помощью параметров переменной важности проекции (VIP). Оценки VIP использовались для ранжирования способности разных таксонов различать разные группы. Таксон с оценкой VIP >1,0 считался важным при различении. Категории KEGG с общей относительной численностью во всех образцах <1 % были удалены. Величины эффекта идентифицированы как значимые (p<0.05) были оценены различия между группами для поиска дискриминационной ортологии KEGG (KO) с помощью LDA с использованием онлайн-системы Galaxy (https://huttenhower.sph.harvard.edu/galaxy). Только функциональные категории с логарифмическими баллами LDA> 2,0 считались дифференциальными сигнатурами, которые лучше различают группы GDM+ и  GDM-.

Анализ соответствия и сочетаемости

Обогащение OTU было рассчитано для каждого типа образцов путем сравнения средней и медианной относительной численности между группами GDM+ и  GDM-.Для сетевого анализа совместной встречаемости бактериальные корреляции в материнских и неонатальных образцах с ГСД и без него были рассчитаны соответственно на основе относительной численности каждого рода с использованием SparCC со 100 бутстрапами для оценки значения p.18 Значения корреляции со значением p <0,05 были сохранены. Сети совместной встречаемости микробиоты полости рта, кишечника и влагалища матери визуализировали с помощью igraph (http://igraph.org). Близость и собственный вектор узлов были рассчитаны для измерения центральности узлов в каждой сети.Соответствие бактериальных корреляций между материнской и неонатальной микробиотой, связанной с ГСД, было установлено путем подсчета одних и тех же бактериальных корреляций в разных типах образцов и визуализировалось с помощью OmicCircos.19

Реконструкция метаболического пути

KO Функциональное профилирование микробиоты мекония новорожденных было выполнено с использованием сборок, полученных на основе данных полногеномного дробовика (WGS). Прочтения низкого качества сначала вырезались из необработанных данных секвенирования с помощью Trimmomatic.20 Высококачественные прочтения были собраны de novo в контиги с использованием metaSPAdes и metaSort с параметрами по умолчанию.21 22 Затем мы выполнили предсказание генов с использованием PROKKA V.1.11 для этих каркасов,23 и предсказанные белки были отнесены к KO с использованием Автоматический сервер аннотаций KEGG.24 Обрезанные высококачественные прочтения, расположенные на заданных каркасах, были подсчитаны для расчета количества KOs в каждом образце с использованием выравнивателя Берроуза-Уилера (BWA).25 Матрица была нормализована путем деления абсолютного количества каждого функционального гена. по общему количеству прочтений, отнесенных к функциональным генам в каждом образце.Контролируемый анализ был проведен с использованием LDA для выявления микробных функциональных путей, которые по-разному экспрессировались в микробиоте кишечника новорожденных, рожденных женщинами с разным статусом уровня глюкозы.

Анализ вирома и подвидов

После удаления последовательностей ДНК человека были измерены таксономия и численность вирусов и бактериофагов в микробиоте мекония новорожденных путем сопоставления результатов секвенирования WGS с пользовательской базой данных. Эта база данных была создана путем объединения геномных последовательностей вирусов и фагов из NCBI и PhAnToMe после удаления дубликатов, как описано в нашем предыдущем исследовании.26 Прочтения были проведены BLASTX для этой базы данных с порогом E -значение <10 −5 с использованием DIAMOND.27 Наименьший общий предок всех таксонов в собранных совпадениях BLAST был рассчитан и использован для определения таксономического происхождения. Альфа-разнообразие вирусных и фаговых сообществ рассчитывали с использованием вегана (https://cran.r-project.org/web/packages/vegan). Для профилирования видов бактерий на уровне штаммов по данным метагеномного секвенирования геномы 35 Escherichia и 69 Lactobacillus , выделенные из полости рта, кишечника или влагалища человека, были получены из HMP и взяты в качестве эталонов.Чтения WGS каждого образца мекония были сопоставлены с этими эталонными геномами с использованием BWA.

Результаты

Мы обследовали 140 новорожденных и 346 беременных женщин и получили в общей сложности 1062 образца, включая слюну, аспираты из глотки, меконий и амниотическую жидкость новорожденных, а также слюну, фекалии и вагинальные выделения беременных женщин (дополнительная онлайн-таблица S1). . Подавляющее большинство неонатальных образцов, особенно амниотической жидкости, было взято при кесаревом сечении (76 кесаревых сечений против 17 вагинальных родов), чтобы избежать возможного заражения вагинальной флорой.Для каждого образца были секвенированы участки 16S рРНК V3-V4, и по 233 образцам не удалось получить данные, и они были исключены из следующих анализов.

Секвенирование гена 16S рРНК подходящих 248 неонатальных (64 амниотической жидкости, 20 оральных, 81 фарингеальных и 83 мекониальных) и 581 материнских (175 оральных, 147 кишечных и 259 вагинальных) образцов дало 309 млн прочтений PE (2×250 bp ) с ~373 241 чтением на образец. Каждая пара прочтений PE была объединена в одну последовательность путем перекрытия. Перекрытия составляли 25–75  п.н. для каждого образца (дополнительный онлайн-рисунок S1A), и более 80% прочтений PE были успешно объединены в длинные последовательности в 94.3% образцов (дополнительный онлайн-рисунок S1B). Кроме того, согласно оценке охвата и кривой разрежения Гуда (дополнительный онлайн-рисунок S1C,D), количество последовательностей может хорошо отражать микробное разнообразие каждого сообщества. Было небольшое расхождение, когда для классификации OTU были выбраны разные методы (дополнительный онлайн-рисунок S1E). Все неонатальные образцы и половина материнских образцов (n = 289), собранные во время родов, были использованы для изучения возможного микробного сдвига на нескольких участках тела, страдающих ГСД (дополнительная онлайн-таблица S2).Оставшаяся половина материнских образцов (95 пероральных, 98 кишечных и 99 вагинальных образцов) использовались в качестве наборов данных для проверки. Подмножество образцов мекония было выбрано случайным образом для метагеномного секвенирования, и 48 из 50 образцов (24 для GDM+ и 24 для GDM-) были успешно секвенированы, в результате чего было получено более 1,5 миллиарда прочтений PE (2×125 bp).

Изменение материнской микробиоты в различных участках тела при ГСД

Чтобы выяснить, может ли материнская микробиота зависеть от уровня глюкозы, мы сначала исследовали микробный сдвиг беременных женщин, у которых был диагностирован ГСД.Соотношение общих или уникальных OTU в материнских оральных, кишечных и вагинальных образцах оценивали, чтобы определить, оказывает ли ГСД сходное влияние на разные участки тела. Мы обнаружили, что пациенты с ГСД (ГСД+) имели больше OTU по крайней мере в двух участках тела, чем беременные женщины без ГСД (GDM-), причем примерно 57,6% OTU появлялись только в одном участке тела при GDM- по сравнению с 47,0% при GDM+. рисунок 1А). Кроме того, мы рассчитали расстояния Брея-Кертиса, используя нормированное количество OTU. Расстояния между образцами любых двух участков тела были значительно меньше при GDM+ , чем при GDM- (p<0.05, критерий Манна-Уитни) (рис. 1В). Эти результаты показывают, что микробный сдвиг в материнской микробиоте различных участков тела может быть связан с ГСД во время беременности.

Рисунок 1

Микробные вариации беременных, страдающих гестационным сахарным диабетом (ГСД). (A) Доли общих операционных таксономических единиц (OTU) среди материнской оральной, кишечной и вагинальной микробиоты. Общая OTU означает, что определенная OTU была обнаружена в двух или трех участках тела. (B) Различия в бактериальном сообществе между любыми двумя участками тела материнских образцов.Расстояния Брея-Кертиса были рассчитаны независимо для групп GDM+ и GDM-. VS представляет против. Статистическая значимость определялась критерием Манна-Уитни. (C – E) Относительное обилие типов бактерий в микробиоте полости рта, кишечника и влагалища беременных женщин. (F–H) Роды бактерий со значительными (критерий Манна-Уитни с коррекцией частоты ложных открытий (FDR); *p<0,1) различиями между группами GDM+ и  GDM-. Численность рода в каждой выборке нормирована на 100 000 прочтений. (I–K) Корреляция между значительно отличающимися бактериями и значениями перорального теста на толерантность к глюкозе (OGTT).Метки 0 час, 1 час и 2 часа под диаграммами представляют моменты времени тестирования OGTT. Пара прямоугольников указывает соотношение бактерий, соответствующее уровням глюкозы в крови ниже (левое поле) или выше (правое поле) пороговых значений (5,1 через 0 часов, 10,0 через 1 час и 8,5 через 2 часа во время ПГТТ). На значимое различие (критерий Манна-Уитни, p<0,05) указывает символ красного цвета, тогда как ns в синем цвете обозначает недостоверное различие (критерий Манна-Уитни, p≥0,05).

Чтобы дополнительно продемонстрировать эти вариации, соответствующие ГСД в разных участках тела, мы сравнили обилие бактерий между группами на уровне типов.Наибольшие изменения произошли в полости рта: при GDM+ было обнаружено больше протеобактерий (p<0,05, критерий Манна-Уитни с коррекцией частоты ложных открытий (FDR) с использованием метода Бенджамини-Хохберга), но меньше фирмикутов (p<0,01) (рис. 1C). ). Не было выявлено явных изменений ни кишечной, ни вагинальной микробиоты (рис. 1D, E). Затем был проведен PLS-DA для улучшения разрешения флоры GDM. От семи до девяти родов со значением VIP> 1 было обнаружено на трех участках тела (дополнительный онлайн-рисунок S2A–F).Для проверки микробных вариаций, соответствующих ГСД, были использованы 95 пероральных, 98 кишечных и 99 вагинальных образцов, взятых у второй когорты беременных женщин. Около 77,8% (7 из 9), 88,9% (8 из 9) и 71,4% (5 из 7) родов VIP, идентифицированных в наборах данных первой партии, могли быть проверены во второй партии, и большинство из них проявляли постоянное обогащение или истощение в двух когортах (рисунок 1F–H и онлайн-дополнительный рисунок S2G–I). Для дальнейшего изучения взаимосвязи между этими родами и ГСД мы связали их обилие с результатами ОГТТ.Пороговые значения (5,1 через 0 часов, 10,0 через 1 час и 8,5 через 2 часа во время ПГТТ) основаны на диагностических критериях, рекомендованных Международной ассоциацией групп по изучению диабета и беременности в 2011 году. Как показано на рисунке 1I–K, относительная численность этих бактерий сильно коррелировала со значениями OGTT (p<0,05, критерий Манна-Уитни).

Микробиота новорожденных, чьи матери страдали от ГСД, значительно отличается от контрольной группы

Чтобы изучить возможное влияние ГСД на неонатальную микробиоту, мы затем исследовали состав и структуру сообщества новорожденных.В анализе основных координат (PCoA) невзвешенных расстояний UniFrac образцы были сгруппированы в основном по участкам тела с отчетливыми материнскими оральными, кишечными и вагинальными кластерами, а также неонатальными скоплениями глотки, мекония и амниотической жидкости (рис. 2А). В неонатальных образцах из разных участков тела наблюдалось специфическое для участков тела скопление, хотя разделение было не таким заметным, как у матерей. Кроме того, мы рассчитали расстояние Брея-Кертиса внутри или между участками тела, чтобы количественно оценить сходство сообщества одного и того же типа выборки.Расстояния сообщества в образцах, полученных с одного и того же участка тела, как и ожидалось, были меньше, чем между разными участками тела (рис. 2B), что дополнительно подтвердило результаты кластеризации с помощью PCoA. Мы рассчитали расстояния Брея-Кертиса между неонатальными и материнскими образцами. В результате, за единственным исключением нескольких образцов детей, рожденных естественным путем, которые, очевидно, происходили из вагинального сообщества матери, способ родоразрешения оказал лишь очень незначительное влияние на микробиоту новорожденного (рис. 2C).Более того, микробиота новорожденных демонстрировала более высокое альфа-разнообразие, чем вагинальная микробиота (рис. 2D). Видовое богатство образцов фарингеальной и амниотической жидкости было даже сравнимо с материнским оральным и кишечным сообществами, микробное разнообразие которых было довольно высоким (онлайн-дополнительный рисунок S3). Неонатальная микробиота каждого участка тела содержала уникальную структуру сообщества (рис. 2Е). Напротив, материнские сообщества этих трех участков тела показали типичную структуру микробиоты взрослого человека (дополнительный онлайн-рисунок S4).

Рисунок 2

Колонизация и специфичность микробиоты новорожденных при рождении к участкам тела. (A) Анализ основных координат (PCoA) невзвешенных расстояний UniFrac для образцов материнской полости рта, кишечника и влагалища, а также образцов амниотической жидкости новорожденных, образцов полости рта, глотки и мекония. Эллипсы представляют 95% ДИ. (B) Различия в бактериальном сообществе внутри и между участками тела. Метки Phar, Inte, Amni и Vagi представляют фарингеальную, кишечную, амниотическую жидкость и вагинальную микробиоту соответственно.Приведено среднее расстояние Брея-Кертиса для каждой группы попарных сравнений. Красные и синие тени обозначают наименьшее и наибольшее значения в каждом столбце соответственно. (C) Влияние способов доставки на неонатальные бактериальные сообщества. Три края треугольника представляют микробиоту полости рта (коричневый), кишечника (желтый) и влагалища (зеленый) матери. Каждая полая точка представляет неонатальный образец, а расстояние от нее по вертикали до трех краев треугольника указывает среднее расстояние Брея-Кертиса между этим образцом и материнскими образцами.Точки ближе к краям означают, что такие неонатальные образцы более похожи по бактериальному сообществу на указанную материнскую микробиоту. (D) Альфа-разнообразие неонатальной и материнской микробиоты. Скрипка с коробчатой ​​диаграммой показывает медиану и IQR индексов разнообразия типа выборки, а ширина скрипки представляет плотность распределения индексов. (E) Таксономическое профилирование микробиоты глотки, кишечника и амниотической жидкости новорожденных. Средняя относительная численность каждой таксономической категории представлена ​​толщиной ветви.Каждый узел в филогенетическом дереве представляет один микробный таксон.

Учитывая, что микробиота новорожденных могла быть установлена ​​при рождении, мы задались вопросом, будет ли такое микробное сообщество формироваться состоянием здоровья беременных женщин во время беременности. Соответственно, расстояния Брея-Кертиса были рассчитаны с использованием количества OTU микробиома из образцов амниотической жидкости, глотки и мекония для оценки влияния ГСД на микробиоту новорожденных. Мы обнаружили, что расстояния между тремя типами выборок в GDM+ были значительно меньше, чем в GDM- (p<0.001, критерий Манна-Уитни) (рис. 3А), из чего следует, что ГСД может влиять на микробиоту новорожденных и, следовательно, приводить к гомогенности сообщества для нескольких типов образцов. Эта тенденция к изменению расстояния до сообщества соответствовала той, которая наблюдалась в материнской оральной, кишечной и вагинальной микробиоте (рис. 1В). СПКЯ продемонстрировал минимальные различия между состоянием здоровья и заболеванием амниотической жидкости (Adonis p<0,001, R 2 =0,069), глоточный (адонис p<0.001, Р 2 =0,050) и меконий (горицвет р<0,05, R 2 =0,026) микробиоты (рис. 3B–D). Образцы были сгруппированы в основном в группы GDM+ и  GDM-. Эти результаты показывают, что микробный состав и вариации как матери, так и новорожденного могут зависеть от состояния здоровья беременной женщины. Воздействие ГСД на микробы во время беременности может вертикально передаваться ребенку во время беременности.

Рисунок 3

Неонатальная микробиота, связанная с гестационным сахарным диабетом (ГСД).(A) Различия бактериального сообщества в неонатальной микробиоте. Расстояния Брея-Кертиса были рассчитаны для образцов GDM+ и GDM- независимо. Статистическая значимость определялась критерием Манна-Уитни. (B-D) Анализ основных координат (PCoA) невзвешенных расстояний UniFrac для амниотической жидкости, микробиоты глотки и мекония. Эллипсы представляют 95% ДИ. (E – G) Наиболее распространенные роды со значительной разницей между группами GDM+ и  GDM-. Численность рода в каждой выборке нормирована на 100 000 прочтений.Критерий Манна-Уитни с коррекцией частоты ложных открытий (FDR): нет. *р<0,1; *р<0,05; **р<0,01; ***р<0,001. Пара таксонов была выделена темным цветом, поскольку их относительное обилие было самым большим среди значительно обогащенных и обедненных родов GDM+ в каждом типе образцов. (H – J) Корреляция между значительно отличающимися бактериями микробиоты новорожденных и значениями теста на толерантность к глюкозе (OGTT). Метки 0 час, 1 час и 2 часа представляют собой три точки времени тестирования OGTT.Пара прямоугольников показывает соотношение бактерий, соответствующее уровням глюкозы в крови ниже (левое поле) или выше (правое поле) пороговых значений (5,1 через 0 часов, 10,0 через 1 час и 8,5 через 2 часа во время ПГТТ). тест Манна-Уитни; *р<0,05; **р<0,01; ***р<0,001; нс р≥0,05.

Обилие бактерий между группами GDM+ и  GDM- дополнительно сравнивали на уровне рода, чтобы прояснить специфичные для участка тела вариации, связанные с GDM в микробиоте новорожденных. Как показано на рисунке 3E-G, образцы амниотической жидкости содержали больше родов со значительными межгрупповыми различиями, чем образцы из глотки или мекония (p<0.1, критерий Манна-Уитни с коррекцией FDR) среди 30 наиболее распространенных родов, что указывает на большую микробную дифференциацию в амниотической жидкости (рис. 3B–D). Чтобы изучить корреляцию между дискриминационными бактериями и ГСД, мы выбрали наиболее распространенные обогащенные или обедненные роды и рассчитали корреляцию их численности с соответствующими материнскими значениями OGTT. В результате в нескольких группах наблюдались сильные корреляции (рисунок 3H–J и дополнительный онлайн-рисунок S5). Мы также провели анализ PLS-DA в неонатальных образцах, чтобы определить дифференциальные признаки между группами здоровья и болезней (онлайн-дополнительный рисунок S6).Роды VIP, такие как Prevotella , Streptococcus , Bacteroides и Lactobacillus , преобладали в нескольких типах образцов материнской и неонатальной микробиоты, что отражает их возможное значение для ответа на ГСД в разных поколениях и участках тела.

Согласованность микробных вариаций между матерями и новорожденными, страдающими ГСД

Учитывая, что как материнские, так и неонатальные микробиомы различных участков тела были заметно изменены при ГСД, мы стремились исследовать соответствие микробных вариаций между матерями и новорожденными.Сначала мы подсчитали количество OTU, обогащенных или обедненных, у новорожденных с GDM, а затем сосредоточились на тех, которые были общими для материнских образцов. OTU, которая была обогащена (или обеднена) как материнской, так и неонатальной микробиотой GDM+ , определялась как изменяющаяся по одной и той же тенденции. Напротив, OTU, которая была обогащена микробиотой новорожденного, но обеднена материнской микробиотой GDM+, была определена как противоположная тенденция, и наоборот. Соответственно, были подсчитаны таксономия и количество OTU, различающиеся по одной и той же тенденции в материнской и неонатальной микробиоте, и было обнаружено, что большое количество OTU с высокой распространенностью варьируется с той же тенденцией.Наиболее заметная согласованность в микробной изменчивости была показана между амниотической жидкостью и микробиотой ротовой полости матери (рис. 4A, B и дополнительная онлайн-рис. S7), в которой большинство наиболее распространенных OTU варьировались с той же тенденцией. Кроме того, было обнаружено, что почти 100 OTU различаются с одинаковой тенденцией в одном типе материнских и трех неонатальных образцах. Prevotella , Streptococcus и Bacteroides были наиболее распространенными таксонами, демонстрирующими соответствие микробных вариаций между матерями и новорожденными (дополнительные онлайн-рисунки S8–S11).Вместе с Lactobacillus и Faecalibacterium (рис. 4C–E) эти бактерии соответствовали общим родам VIP типов материнских и неонатальных образцов (дополнительные онлайн-рисунки S2 и S6), что также отражало их важность для ответа на ГСД. Эти наблюдения доказали, что, несмотря на вариации в зависимости от участка тела, ГСД может оказывать одинаковое влияние как на материнскую, так и на неонатальную микробиоту.

Рисунок 4

Сходные микробные сдвиги между материнской и неонатальной микробиотой, связанные с гестационным сахарным диабетом (ГСД).Численность операционных таксономических единиц (OTU) в каждой выборке была нормализована до 100 000 прочтений. (A) Согласованность вариаций OTU между амниотической жидкостью и микробиотой ротовой полости матери. Среднее относительное количество 100 самых распространенных OTU сравнивали между группами GDM+ и  GDM-. Сплошные точки представляют OTU микробиоты амниотической жидкости, а полые точки представляют микробиоту ротовой полости матери. Красные точки обозначают OTU, изменяющиеся по одной и той же тенденции, а синие точки обозначают противоположную тенденцию. (B) Совокупное количество OTU, различающихся по той же или противоположной тенденции.р<0,001, t-критерий. (C–E) Наиболее распространенные таксоны, демонстрирующие соответствие микробных вариаций у матерей и новорожденных. Каждая цветная полоса указывает частоту OTU определенного рода. Красная полоса представляет переменную важность для проекционного (VIP) рода, связанного с GDM, который является общим для типов материнских и неонатальных образцов.

Чтобы исследовать соответствие микробного сосуществования у матерей и новорожденных, мы затем рассчитали корреляции между родами бактерий в материнских и неонатальных образцах с ГСД и без него.Приблизительно 47–62 рода (узлы) и 60–134 соединения (ребра) сохранялись при различных порогах корреляции (0,4–0,5) (онлайн-дополнительный рисунок S12A,B) в сетях совместного появления материнской ротовой, кишечной и микробиота влагалища. При сравнении сетей GDM+ с сетями GDM- их компоненты и топографии были совершенно разными, и наиболее заметное различие связано с связями родов VIP с другими бактериями (рис. 5A–C). Чтобы количественно оценить эту разницу, мы подсчитали количество ребер и центральность узлов в материнских микробных сетях при различном статусе GDM.Несмотря на наличие нескольких перекрывающихся ребер, десятки ребер характерны для GDM+ или  GDM- (рис. 5D), а близость и собственный вектор общих узлов между GDM+ и  GDM- также сильно различаются (рис. 5E и онлайн-дополнительный рисунок S12C). Кроме того, внутригрупповая разница всегда была очевидна в каждом интервале значений корреляции (дополнительный онлайн-рисунок S12D-F). Что касается новорожденных, бактериальные корреляции также были различны между GDM+ и  GDM- (рисунок 5F,G и дополнительный онлайн-рисунок S12G).Например, в микробиоте глотки около 69,2% корреляций со значением корреляции> 0,4  существовало только при GDM+, в то время как ~18,7% присутствовало только при GDM- (рис. 5F). Аналогичные результаты были также обнаружены в меконии: 76,9% и 15,3% уникальных корреляций присутствовали в GDM+ и  GDM- соответственно (рис. 5G). Примечательно, что бактериальные корреляции были очень консервативными между материнскими и неонатальными образцами, связанными с ГСД (рисунок 5H и дополнительный онлайн-рисунок S12H). Примерно 88,8% всех бактериальных связей имели одинаковую тенденцию совпадения между поколениями, а 69.1% были обнаружены только при GDM+, но не при GDM-. Среди них положительная корреляция между Neisseria и Haemophilus и отрицательная корреляция между Lactobacillus и несколькими бактериями VIP (включая Porphyromonas и Bacteroides ) присутствовали почти во всех участках тела матери и новорожденного (онлайн-дополнительный рисунок S1) ). Кроме того, соединения, содержащие Blautia , Coprococcus , Roseburia и Sutterella , показали высокую частоту одновременного появления в нескольких типах образцов, что предполагает их универсальную принадлежность к микробиоте, связанной с ГСД.В соответствии с этими результатами можно предположить, что постоянство микробной изменчивости у матерей и новорожденных, страдающих ГСД, произошло в отношении количества бактерий и их взаимодействия. Рисунок 5 (A – C) Сети совместного появления материнской оральной, кишечной и вагинальной микробиоты GDM + (левая панель) и GDM- (правая панель). Сеть совместной встречаемости была выведена для каждого типа материнской выборки путем попарной корреляции относительной численности (нормализованной до 100 000) для всех родов.Каждый узел в сети указывает на род бактерий. Размер узла представляет собой среднюю относительную численность одного рода в каждом типе материнской выборки. Узлы зеленого цвета показывают переменную важность для родов проекций (VIP), связанных с GDM. Сохраняются только бактериальные связи (ребра), превышающие пороговые значения (значения корреляции> 0,4, 0,45 и 0,5 в трех сетях соответственно). Ширина края представляет собой значение корреляции, поддерживающее это соединение. Цвет края показывает положительную (красный) и отрицательную (синий) корреляции соответственно.(D, E) Расхождения в бактериальных сетях совместного появления между материнским GDM+ и  GDM-. Было подсчитано количество уникальных и общих ребер, а также центральность (ранг близости) и несоответствия узлов в сетях совместного появления GDM+ и  GDM- соответственно. (F – G) Расхождения бактериальных корреляций между неонатальной микробиотой GDM+ и  GDM-. Каждая ячейка показывает количество одной и той же пары бактериальных корреляций, встречающихся как в GDM+ , так и в  GDM-, с изменениями цвета, представляющими слабую (серый) или сильную (синий и красный) корреляции соответственно.(H) Согласованность бактериальных корреляций между материнской и неонатальной микробиотой, связанной с ГСД. Соответствие было установлено путем подсчета одних и тех же бактериальных корреляций (отсечка > 0,4) для разных типов образцов. Каждая точка во внешнем цикле представляет собой одно соединение двух коррелирующих бактерий (по крайней мере, одна относится к роду VIP). Кривая красного цвета (возникающая только при ГСД+) и серая (возникающая как при ГСД+, так и при  ГСД-) обозначает одну и ту же тенденцию совместного появления такой связи между материнской и неонатальной микробиотой, а кривая синего цвета обозначает противоположную тенденцию.

Измененный микробный метаболизм и повышенная вирусная нагрузка при ГСД+ меконий

Микробиота кишечника новорожденных важна для метаболизма и иммунитета развивающихся младенцев и взрослых. микробиоты мекония, и поэтому для секвенирования WGS было отобрано подмножество образцов мекония. Было успешно секвенировано 48 образцов, в результате чего было получено более 375 ГБ данных секвенирования WGS.Метагеномное таксономическое профилирование по данным WGS-секвенирования образцов мекония было выполнено с использованием MetaPhlAn.31 По сравнению с таксономическими профилями мекония на основе 16S рРНК, метагеномное секвенирование создает очень похожую структуру бактериального сообщества (дополнительная онлайн-рисунок S13). Мы искали метаболические различия между кишечной микробиотой новорожденных, рожденных женщинами с ГСД и без него. В результате в группе с ГСД+ были показаны меньшие индексы Пиелоу для нокаутов (рис. 6А), что означает, что микробиота новорожденных в этой группе была менее однородной, чем в группе с ГСД-.LDA использовался для выявления межгрупповых различий в КО, и большое количество КО были истощены при ГСД+, что указывает на снижение метаболических возможностей по сравнению с микробиотой кишечника новорожденных, рожденных женщинами без ГСД (рисунок 6B и онлайн-дополнительная таблица S3). Отсутствие таких метаболических путей может оказывать неблагоприятное воздействие на усвоение пищи или определенные метаболические способности новорожденных.

Рисунок 6

Микробные и функциональные изменения микробиоты мекония, связанные с гестационным сахарным диабетом (ГСД).(A) Четность ортологии KEGG (KO). (B) Количество обогащенных KOs. (C, D) Распределение вирусного богатства и равномерности. (E, F) Относительное обилие вирусов герпеса и поксвируса. Обилие вирусов в каждом образце нормализовали до 100 000 прочтений. (G, H) Распространенность мастаденовируса и папилломавируса в меконии. (I, J) Значительная дифференциация штаммов Escherichia и Lactobacillus между GDM+ и GDM-. Геномы штаммов Escherichia и Lactobacillus , выделенных из ротовой полости, кишечника или влагалища человека, были загружены из Human Microbiome Project (HMP) и взяты в качестве эталонов.Прочтения секвенирования были сопоставлены с этими эталонами, а количество штаммов в каждом образце было нормализовано до 100 000 прочтений.

Мы также сравнили данные WGS с известными вирусными геномами, чтобы обнаружить возможные изменения в вироме мекония. Хотя более высокое богатство (количество наблюдаемых вирусных видов) эукариотических вирусов в меконии GDM+ не было значительным (рисунок 6C), как вирусная однородность (индекс Пиелоу в каждом образце), так и индексы альфа-разнообразия были значительно ниже, чем у GDM- ( р<0.05, критерий Манна-Уитни) (рисунок 6D и дополнительный онлайн-рисунок S14A–D). Напротив, не было очевидных межгрупповых различий в альфа-разнообразии бактериофагов (дополнительный онлайн-рисунок S14E-H). Дальнейшее исследование оценило относительное количество узнаваемых вирусных таксонов и выявило четыре типа вирусов, которые различались в зависимости от состояния здоровья беременных женщин, включая герпесвирус, поксвирус, мастаденовирус и папилломавирус. Среди них герпесвирус и поксвирус были более распространены в группе GDM+ (рисунок 6E,F), а мастаденовирус и папилломавирус с высокой численностью также были более распространены в образцах этой группы (рисунок 6G,H).Эти данные свидетельствуют о том, что беременные женщины, страдающие ГСД, увеличивают распространенность вирусов в кишечной микробиоте новорожденных и могут привести к возникновению популяции, очень уязвимой для воздействия этих вирусов.

Наконец, чтобы исследовать внутривидовое разнообразие некоторых неонатальных кишечных бактерий, мы сопоставили данные WGS-секвенирования образцов мекония с доступными в настоящее время эталонными геномами Escherichia и Lactobacillus , которые включают геномы 35 Escherichia и 69 Lactobacillus из ротовой полости человека, кишечника и влагалища, извлеченных из HMP (рис. 6I,J).Учитывались только уникально картированные чтения этих геномов. Большое количество прочтений может быть отнесено к геномам эталонных штаммов, выделенных из полости рта и кишечника человека, помимо влагалища, что еще раз подтвердило наблюдение о том, что микробиота новорожденных происходит не только из влагалища. Кроме того, мы заметили, что как Escherichia , так и Lactobacillus показали различия в уровне штамма между новорожденными, рожденными матерями с ГСД и без него. Примечательно, что штамма Lactobacillus iners были значительно более распространены в GDM+ (p<0.05, критерий Манна-Уитни с коррекцией FDR) (рис. 6J). Эти результаты показали, что Lactobacillus spp и их подвидов у новорожденных могут зависеть от статуса ГСД их матерей.

Обсуждение

Большинство неонатальных образцов в нашем исследовании было собрано в течение нескольких секунд после кесарева сечения, что позволило нам исключить возможность микробного воздействия и колонизации in vitro . Присутствие микробов в этих образцах указывает на установление микробиоты плода, в отличие от обнаружения микробов в меконии, который, как сомневались, был результатом постнатального заражения.11 Секвенирование гена 16S рРНК выявило бактериальные сигналы от каждого участка тела новорожденного, а некоторые участки тела (такие как микробиота глотки и амниотической жидкости) даже имеют относительно высокое видовое богатство. В сочетании с заметными различиями в таксономическом составе и структуре сообщества между микробиотой новорожденного и матери эти результаты показывают, что микробные нуклеиновые кислоты, обнаруженные в амниотической жидкости и неонатальных образцах, не все являются контаминантами от матери, как предполагалось ранее.32 Кроме того, как показано в анализе РПЖ и несходства Брея-Кертиса, очень ясно, что неонатальные образцы были сгруппированы в соответствии с типами образцов. Не было бы наблюдаемой кластеризации между различными типами образцов, если бы их микробы происходили от потенциальной материнской контаминации или контаминации реагентами. Более того, живые бактерии были успешно культивированы из амниотической жидкости беременных женщин с ГСД+ и  ГСД- (данные не показаны). Несмотря на то, что в одном обзоре в качестве примера использовались стерильные мыши, чтобы отвергнуть гипотезу микробной колонизации внутриутробно, мы предполагаем, что причиной могут быть различия в плацентарных клеточных структурах и продолжительности беременности между мышами и людьми.Два слоя синцитиотрофобластов и один полный слой цитотрофобластов в плаценте мыши обеспечивают прочный барьер для предотвращения вертикальной передачи микробов от матери к потомству, 33 а короткая продолжительность беременности (19–21 день) также снижает вероятность проникновения бактерий в матку мыши. Напротив, у людей в плаценте имеется только один слой синцитиотрофобластов, и чем дольше беременность дает бактериям больше шансов проникнуть в матку. Таксономическое профилирование как 16S рРНК, так и метагеномного секвенирования показало, что Enterobacteriaceae и Escherichia являются наиболее распространенными таксонами в образцах мекония.Это согласуется с предыдущими исследованиями микробиоты либо плаценты34, либо мекония.15 Эти результаты позволяют предположить, что Escherichia преобладает внутриутробно и в раннем возрасте.

В сочетании с результатами предыдущих исследований10, 35 мы считаем, что ГСД может влиять на микробиоту как беременных женщин, так и новорожденных на различных участках тела во время беременности. Хотя ОГТТ считается золотым стандартом диагностики ГСД, мониторинг требует анализа крови и проводится только между 24 и 28 неделями беременности.6 Существует сильная корреляция между несколькими дискриминационными бактериями и значениями OGTT. Например, в материнской микробиоте пероральные отношения Neisseria / Leptotrichia положительно коррелировали со значениями глюкозы в крови, особенно с концентрациями глюкозы в крови натощак, которые отражают суточную секреторную способность базального инсулина. Низкие соотношения кишечных Faecalibacterium / Fusobacterium соответствовали высоким значениям уровня глюкозы в крови, где корреляция была высоко значимой между бактериальными соотношениями и 2-часовыми уровнями глюкозы в крови, отражая способность к регуляции и восстановлению после приема сахара.Кроме того, высокие вагинальные соотношения Prevotella / Aerococcus также коррелировали с высокими значениями глюкозы в крови, особенно с 1 - и 2-часовыми значениями OGTT. Хотя материнские образцы, собранные до ПГТТ, необходимы, это может обеспечить многообещающий подход к разработке биомаркеров ГСД, особенно для оральных микробов, которые очень удобны для отбора проб и имеют самые большие микробные вариации, связанные с ГСД.

Как в материнской, так и в неонатальной микробиоте микробные вариации имеют тенденцию к конвергенции на участках тела при GDM+, которые демонстрируют более сходную структуру сообщества, чем при GDM-.Микробы, различающиеся по той же тенденции между материнской и неонатальной микробиотой, также наблюдались в нашем исследовании, что свидетельствует о межпоколенческой согласованности микробных вариаций, связанных с ГСД. Эти результаты свидетельствуют о том, что ГСД может оказывать одинаковое влияние на микробиоту в разных поколениях и на разных участках тела. Такие микробные сдвиги, вероятно, увеличивают риск гестационных осложнений или нежелательных исходов. Более низкая равномерность, но большее истощение КО, а также более высокая численность или распространенность некоторых эукариотических вирусов могут привести к снижению метаболических способностей и большему воздействию вирусов на новорожденных с ГСД, чем без него.Кроме того, считается, что L. iners в большей степени способствует возникновению аномальной микробиоты, что может привести к неблагоприятным последствиям для здоровья. аминокислоты de novo .38 Относительно высокое соотношение этого штамма может снижать эффективность микробного метаболизма аминокислот в пищеварительном тракте новорожденного.

Здесь мы описываем влияние состояния здоровья матери на микробную вертикальную передачу и колонизацию в раннем возрасте.Связи между микробным дисбактериозом в раннем возрасте и большим количеством заболеваний могут свидетельствовать о долгосрочном воздействии исходной микробиоты на здоровье человека. неонатальный микробиом. Эти наблюдения будут способствовать лучшему пониманию происхождения микробиоты человека и вертикальной передачи микробов от матерей к детям. Это исследование проливает свет на другую форму наследования и подчеркивает важность понимания формирования микробиома в раннем возрасте, что предлагает многообещающий подход к модулированию начальной микробной колонизации и взаимодействия с помощью материнского вмешательства для снижения риска неблагоприятных последствий для здоровья.

Дисбактериоз кишечника у младенцев и будущее лактоинженерии для формирования развивающегося кишечного микробиома — Калифорнийский университет в Дэвисе

AU — Zeinali, Lida I.

AU — Giuliano, Shayne

AU — Lakshminrusimha, Satyan

AU — Underwood, Mark A.

N1 — Информация о финансировании: Национальные институты здравоохранения оказали грантовую поддержку Dr.Лакшминрусимха (R01 HD072929) и доктор Андервуд (R21 HD096247). Авторское право издателя: © 2021 Elsevier Inc.

PY — 2021

Y1 — 2021

N2 — Цель: целью данного исследования было изучить роль грудного молока в формировании кишечной микробиоты младенцев и потенциал биоактивных молекул грудного молока для реверсирования тенденции нарастания дисбактериоза кишечника и заболеваний, связанных с дисбиозом. Методы: Этот описательный обзор был основан на недавней и исторической литературе.Выводы. Иммуноглобулины грудного молока, олигосахариды, лактоферрин, лизоцим, мембраны шариков молочного жира и липаза, стимулирующая соли желчных кислот, представляют собой сложные многофункциональные биоактивные молекулы, которые, помимо других важных функций, формируют состав кишечной микробиоты младенцев. Последствия: коэволюция компонентов грудного молока и комменсальных анаэробов, потребляющих грудное молоко, много тысяч лет назад привела к стабильной микробиоте младенцев с низким разнообразием. За последнее столетие внедрение антибиотиков и современных методов гигиены, а также изменения в уходе за новорожденными привели к значительным изменениям в кишечной микробиоте с сопутствующим увеличением риска заболеваний, связанных с дисбиозом.Лучшее понимание механизмов, с помощью которых грудное молоко формирует кишечную микробиоту младенца в уязвимый период развития иммунной системы, необходимо для изменения текущей траектории и уменьшения кишечного дисбиоза и связанных с ним заболеваний.

AB — Цель. Целью данного исследования было изучить роль грудного молока в формировании кишечной микробиоты младенцев и потенциал биоактивных молекул грудного молока в отношении изменения тенденции роста дисбактериоза кишечника и заболеваний, связанных с дисбиозом.Методы: Этот описательный обзор был основан на недавней и исторической литературе. Выводы. Иммуноглобулины грудного молока, олигосахариды, лактоферрин, лизоцим, мембраны шариков молочного жира и липаза, стимулирующая соли желчных кислот, представляют собой сложные многофункциональные биоактивные молекулы, которые, помимо других важных функций, формируют состав кишечной микробиоты младенцев. Последствия: коэволюция компонентов грудного молока и комменсальных анаэробов, потребляющих грудное молоко, много тысяч лет назад привела к стабильной микробиоте младенцев с низким разнообразием.За последнее столетие внедрение антибиотиков и современных методов гигиены, а также изменения в уходе за новорожденными привели к значительным изменениям в кишечной микробиоте с сопутствующим увеличением риска заболеваний, связанных с дисбиозом. Лучшее понимание механизмов, с помощью которых грудное молоко формирует кишечную микробиоту младенца в уязвимый период развития иммунной системы, необходимо для изменения текущей траектории и уменьшения кишечного дисбиоза и связанных с ним заболеваний.

KW — липаза, стимулированная солями желчных кислот

KW — иммуноглобулины грудного молока

KW — олигосахариды грудного молока scopus.com/inward/record.url?scp=85121277836&partnerID=8YFLogxK

UR – http://www.scopus.com/inward/citedby.url?scp=85121277836&partnerID=8YFLogxK

U2 – 10.1016/j.clinthera.j.clinthera.j. 2021.11.005

ДО — 10.1016 / J.CLINTHERA.2021.11.005

M3 — Обзор Статья

AN — Scopus: 85121277836

Jo — клиническая терапевтика

JF — клиническая терапевтика

SN — 0149-2918

ER —

Метагеномический анализ находит У 90% обследованных младенцев в США отсутствуют ключевые кишечные бактерии для использования грудного молока и развития иммунной системы

Крупнейшее исследование на сегодняшний день оценивает широко распространенный, недооцененный риск, связанный с микробиомом, для развития иммунной системы младенцев, устойчивости к антибиотикам, острых состояний, таких как колики и опрелости.[Развить биосистемы, Inc.]

Результаты исследования, проведенного исследователями из Стэнфордского университета, Университета Небраски и Evolve BioSystems, показывают, что у подавляющего большинства младенцев в Соединенных Штатах может наблюдаться значительный дефицит важной кишечной бактерии, которая играет ключевую роль в использовании грудного молока и иммунной системе. системного развития, а также защиту от кишечных патогенов, связанных с распространенными состояниями новорожденных, такими как колики и опрелости. Метагеномное исследование, опубликованное в Scientific Reports , показало, что в кишечном микробиоме примерно девяти из десяти младенцев отсутствовали Bifidobacterium longum subsp.infantis (B. infantis) , тип бактерий, играющих решающую роль в здоровье и развитии младенцев. Было широко задокументировано, что эта специфическая кишечная бактерия оказывает наиболее благотворное влияние на здоровье кишечника младенцев и обладает способностью полностью раскрывать питательные преимущества грудного молока.

Утверждается, что это исследование является крупнейшим на сегодняшний день для оценки широко распространенного дефицита кишечных бактерий среди младенцев в США и связанного с этим снижения функции их кишечных микробиомов.«Подавляющее большинство младенцев испытывают дефицит этой ключевой кишечной бактерии с самых первых недель жизни, и это полностью ускользает от внимания большинства родителей и педиатров», — сказал соавтор исследования Карл Сильвестр, доктор медицинских наук, профессор хирургии и хирургии. педиатрии и заместитель декана по исследованиям здоровья матери и ребенка Стэнфордского университета. «Это исследование дает самую четкую на сегодняшний день картину того, насколько широко распространена эта проблема, и подчеркивает необходимость устранения дефицита B. infantis в кишечнике младенцев с самого начала.Сильвестр и его коллеги сообщили о своих выводах в статье под названием «Метагеномное понимание структуры и функционирования сообщества младенческого микробиома в нескольких местах в Соединенных Штатах».

Неонатальный период представляет собой уникальный этап жизни, когда закладываются «важнейшие основы здоровья на протяжении всей жизни», включая правильное развитие иммунной системы, пишут авторы. Ключом к этой основе здоровья является микробиом кишечника младенцев, который требует присутствия тысяч различных бактерий для выполнения различных функций, от биологических процессов до развития биологических структур и систем.

Присутствуя в микробиоме кишечника младенца, B. infantis расщепляет углеводы, называемые олигосахаридами грудного молока (HMO), которые присутствуют в грудном молоке человека и которые в противном случае были бы недоступны для младенца. B. infantis отличается от других видов Bifidobacteria своей уникальной адаптацией к человеческому грудному молоку и, в частности, своей способностью расщеплять HMO на полезные питательные вещества. Возможно, что более важно, B. infantis  все чаще связывают с развитием иммунной системы младенцев, защитой кишечного тракта младенцев от потенциально опасных бактерий, а также снижением частоты распространенных детских заболеваний, таких как колики и опрелости.

Также было показано, что нарушение кишечного микробиома новорожденных — дисбактериоз — может иметь отношение к сохраняющимся проблемам, таким как повышенный риск иммунологических нарушений в более позднем возрасте и острое хроническое воспаление, отметили исследователи. Дисбактериоз у новорожденных характеризуется существенным дисбалансом между полезными и потенциально патогенными бактериями в желудочно-кишечном тракте.

Имеются убедительные доказательства, характеризующие значительную потерю Bifidobacteria  в кишечнике младенцев за последние 100 лет, при этом исследования указывают на многочисленные факторы, включая более частое родоразрешение путем кесарева сечения, более широкое использование антибиотиков и более широкое использование детских смесей.В результате потери B. infantis кишечник младенцев подвергается большему риску негативных последствий, включая неоптимальный доступ к полноценному человеческому грудному молоку, нарушение развития иммунной системы, увеличение количества вредных кишечных патогенов из-за повышенного pH кишечника. и негативное воздействие на стенку кишечника младенца. «За последние несколько лет появились надежные данные о состоянии микробиома кишечника младенцев в США, свидетельствующие об общей тенденции к дисбактериозу и связанным с ним негативным острым и долгосрочным последствиям для здоровья», — прокомментировали исследователи.

Однако они объяснили, что на сегодняшний день исследователи основывали свои выводы в основном на исследованиях микробиома в одном месте, часто ограниченном географической областью, где были собраны образцы. Небольшие ассоциативные исследования также демонстрируют врожденные ограничения с точки зрения воспроизводимости методов, от сбора образцов до анализа, продолжили они. «В настоящее время имеются ограниченные данные для широкой оценки состояния микробиома кишечника здорового младенца в США», в то время как большинство исследований микробиома младенцев проводилось на недоношенных младенцах, у которых может проявляться нестабильность микробиома и более тяжелый дисбиоз, чем у доношенных детей. .

Для своего недавно опубликованного исследования метагеномики команда собрала образцы кала у 227 младенцев в возрасте до шести месяцев во время визитов педиатра в пяти разных штатах США (Калифорния, Джорджия, Орегон, Пенсильвания, Южная Каролина). Образцы были проанализированы на наличие бактериального типа и количества, которое представляет бактериальный состав в кишечнике младенцев. Образцы фекалий оценивали на способность бактерий полностью использовать человеческое грудное молоко — признак присутствия полезных для здоровья бактерий — а также на наличие в бактериях генов, устойчивых к антибиотикам.

«В частности, мы применили метагеномику дробовика, чтобы охарактеризовать: (1) кишечные бактериальные сообщества здоровых младенцев в США в первые шесть месяцев жизни; (2) экосистемные функции путем определения метаболического потенциала кишечных микробиомов различных энтеротипов для метаболизма олигосахаридов грудного молока (HMO) из грудного молока; и (3) носительство генов устойчивости к антибиотикам (ARG) у младенцев в разных штатах США», — пояснили они. Исследователи не включали образцы младенцев с желтухой или тех, кто либо активно проходил лечение антибиотиками, либо у которых были диагностированы проблемы с всасыванием углеводов в кишечнике из-за влияния, которое такие условия могли оказать на способность организма. младенческий кишечник для выполнения нормальных процессов.

Результаты показали, что потенциально опасные бактерии составляют в среднем 93% всех бактерий в микробиоме кишечника младенцев, причем наиболее распространенными бактериями являются Escherichia coli , Klebsiella pneumoniae , Salmonella , Streptococcus , Staphylococcus , и Clostridium difficile . Известно, что многие из этих бактерий содержат гены, связанные с устойчивостью к антибиотикам. Фактически, в кишечных бактериях было обнаружено в общей сложности 325 генов устойчивости к антибиотикам, причем более половины (54%) из этих генов придают бактериям устойчивость к нескольким антибиотикам.Результаты также показали, что около 97% младенцев «вероятно, отсутствовали B. infantis », сообщили ученые . Учитывая, что B. infantis  считается одной из наиболее распространенных бактерий в желудочно-кишечном тракте младенцев, ее отсутствие у такого широкого круга внешне здоровых младенцев вызывает удивление.

«Это исследование предлагает новую перспективу при рассмотрении младенцев в контексте здорового микробиома и его острых и долгосрочных последствий», — написали они.«Учитывая недавние результаты, связывающие микробиом в раннем возрасте с ключевыми элементами здоровья младенцев, и понимание этого сообщества улучшилось, наши результаты показывают, что у младенцев в Соединенных Штатах есть микробиомы, которые могут не выполнять функции, необходимые в раннем возрасте, включая формирование иммунной системы. системы, защищая от колонизации патогенами и максимизируя питание грудным молоком (например, ОПЗ)».

Как далее отмечает Сильвестр, «кишечник младенца при рождении представляет собой чистый лист и быстро получает бактерии от мамы и окружающей среды.Мы были удивлены не только значительным отсутствием хороших бактерий, но и невероятно высоким присутствием потенциально патогенных бактерий и средой устойчивости к антибиотикам, которая, по-видимому, так широко распространена. Микробиом кишечника младенцев в Соединенных Штатах явно дисфункционален, и мы считаем, что это критический фактор, лежащий в основе многих детских и младенческих заболеваний, которые мы наблюдаем сегодня по всей стране».

Бактериально-грибковые взаимодействия в кишечнике новорожденных влияют на исходы астмы в более позднем возрасте

[Примечание редактора: авторы повторно представили на рассмотрение исправленную версию статьи.Далее следует ответ авторов на первый раунд обзора.]

Рецензент №1:

В этой рукописи описывается связь между избыточным ростом Pichia kudriavzevii в кишечнике мышей и людей и возникновением аллергического заболевания дыхательных путей (ААД) в более позднем возрасте. Здесь авторы воспроизвели свои предыдущие результаты у эквадорских детей, которые показали связь между чрезмерным ростом грибков, особенно уровнями P. kudriavzevii, и AAD в более позднем возрасте, используя популяцию канадских детей.Далее они показали корреляцию у мышей между ранним воздействием P. kudriavzevii при отлучении от груди и усилением воспаления в модели AAD после прекращения воздействия грибка. Опираясь на свою предыдущую работу, в которой были обнаружены более низкие уровни короткоцепочечных жирных кислот у населения с более высоким содержанием P. kudriavzevii, продуцируемого кишечными бактериями, они показали, что более высокие концентрации бутирата и родственных молекул подавляют рост, изменяют морфологию и снижают приверженность к лечению. P. kudriavzevii к эпителиальным клеткам Caco2/T7, что привело их к предложению модели, согласно которой модулирование кишечных бактерий может быть использовано для предотвращения последствий разрастания грибков и сенсибилизации к аллергенам в раннем возрасте.В целом статья интересная, но текст смущает некоторыми ошибками и нестыковками местами.

Благодарим Вас за отзыв, мы искренне благодарны Вам за подробную оценку нашей работы и возможность затронуть эти важные моменты.

1. Для всех столбчатых диаграмм покажите отдельные точки данных (например, рисунок 1) на графиках, чтобы показать распределение данных. Это необходимо, чтобы подтвердить вывод авторов о том, что существует корреляция между людьми с AW и повышенным бременем Pichia или это имеет место только для субпопуляции.Данные о грибковой нагрузке, основанные на 18S, в свете оси y не являются убедительными — точки данных снова должны быть показаны. Почему ДНК Pichia больше, чем общая ДНК грибов?

Отличное замечание. Как справедливо отмечает этот рецензент, это часто наблюдается в исследованиях микробиоты человека, и повышенное бремя Pichia присутствует только для субпопуляции детей в когорте CHILD (6/12 случаев против 36/115 в контрольной группе). Это также то, что мы видели в нашей предыдущей публикации с использованием данных когорты рождения человека в Эквадоре (Arrieta et al., (2018)) (1). Однако мы согласны с тем, что данные в когорте CHILD не столь убедительны, как в исходной статье. Цель этих данных — поддержать использование нами чрезмерного роста Pichia в качестве соответствующей модели, и наши результаты предполагают, что в будущей работе следует использовать более крупные размеры выборки. Учитывая, что это предварительные данные, теперь они перемещены в дополнительный файл, и мы заменили исходные цифры цифрами, показывающими отдельные точки данных. Мы также уточнили нашу формулировку и уменьшили фокус на этих данных:

Строка 98-103: «Более того, в подгруппе из 123 субъектов из когортного исследования CHILD мы обнаружили доказательства, свидетельствующие о том, что канадские младенцы из промышленно развитых стран с высоким риском астмы также демонстрируют чрезмерный рост P.kudriavzevii в трехмесячных образцах стула по сравнению со здоровыми младенцами (дополнительный файл 1). Таким образом, чрезмерный рост P. kudriavzevii в кишечнике в раннем возрасте может представлять собой уместную и широко применимую модель грибкового дисбактериоза кишечника, связанного с астмой».

Благодарим вас за то, что вы указали оси Y на наших графиках. Этот обзор позволил нам более внимательно рассмотреть данные и еще больше подчеркнул полезность отображения отдельных точек данных, как это было предложено.Ось Y графика для ДНК P. kudriavzevii поднята на выброс в контрольной группе, но с показанными отдельными точками данных становится более очевидным, что общая популяция грибов в образцах составляет около 10 -6 , тогда как загрузка P. kudriavzevii меньше. Нагрузки могут казаться одинаковыми по нескольким причинам, и это снова имитирует то, что было замечено в нашей статье JACI 2018 года Арриета и др. Различия в количестве копий ДНК-мишени могут объяснить эти различия.Кроме того, стандартные кривые для рисунка Pichia использовали общую ДНК Pichia (полный геном; ~ 4 копии ITS / геном), тогда как для анализа общей грибковой нагрузки использовались только ампликоны 18S. Следовательно, мы ожидаем, что число Pichia будет отражать большее количество копий ДНК/18S. Наконец, обратите внимание, что анализ, используемый для анализа FungiQuant (метод на основе зонда), отличается от анализа, специфичного для Pichia (метод на основе SYBR), и имеет более длинный ампликон. Если число копий рассчитывается (https://www.idtdna.com/pages/education/decoded/article/calculations-converting-from-nanograms-to-copy-number) после преобразования количества ДНК Pichia в копии ITS (на основе средний размер генома 10.8126 МБ (https://www.ncbi.nlm.nih.gov/genome/?term=Pichia%20kudriavzevii[Organism]&cmd=DetailsSearch) и 4 копии локуса рДНК 18S на геном(2)), результаты показаны на рисунке 1.

2. Для экспериментов, в которых доступны разные данные от каждой мыши, такие как количество Pichia и количество эозинофилов или разные иммунологические маркеры, проведите корреляционный анализ, чтобы определить, подтверждает ли изменчивость, наблюдаемая между мышами, выводы, сделанные в этой статье. серии независимых t-тестов.Имеют ли мыши с самой высокой колонизацией Pichia более сильный иммунный ответ? На нескольких панелях несколько точек данных, по-видимому, определяют различия между группами, если эти данные взяты из одного и того же эксперимента на каждой панели, что необходимо рассмотреть в тексте и в статистическом анализе. Это поддержало бы идею газеты.

Мы согласны с рецензентом в том, что если бы такие данные были доступны, это значительно укрепило бы нашу статью, и это было темой постоянных дискуссий в нашей группе.К сожалению, этот корреляционный анализ невозможен из-за дизайна эксперимента и технических проблем, связанных с получением данных о колонизации для конкретных отдельных щенков, используемых для экспериментов с астмой. Мы обнаружили, что щенки колонизируются Pichia только тогда, когда они содержатся вместе с самками (которые фактически получали лечение), но теряют колонизацию, когда их отнимают от груди в возрасте 19 дней. Поэтому невозможно точно отрегулировать, сколько Pichia получает каждый отдельный щенок.Кроме того, до отъема щенки не производят полностью сформированные образцы фекалий, поэтому колонизация должна быть измерена как анализ конечной точки, т.е. путем сбора тканей кишечника. В результате данные о колонизации собираются у разных животных, а не у тех, которые были доставлены в конечную точку AAD.

Мы также обеспокоены тем, что колонизация детенышей будет варьироваться у животных в течение первых 2 недель жизни (учитывая стохастическое воздействие, копрофагию и т. д.), и обеспокоены тем, что корреляция бремени Pichia в любой момент времени с воспалительными маркерами будет неточная оценка.

Несмотря на эти ограничения, нам было важно решить эту проблему. Поэтому мы повторили полный 12-недельный эксперимент, и образцы фекалий были собраны во время и после периода колонизации, чтобы соотнести нагрузку Pichia (определяемую с помощью подсчета колоний) с исходами астмы. К сожалению, этот эксперимент подтвердил, что самый ранний момент времени, когда можно было получить сформированный образец фекалий от детенышей, составлял 18 дней жизни, и, учитывая низкую колонизацию в этот момент времени, не было обнаружено корреляции между количеством колоний и параметрами исхода астмы.

Что касается «ответивших» и «неответивших» мышей, мы заметили, что самки мышей оказались более чувствительными к воздействию грибкового дисбиоза на AAD (обратите внимание, что самки и самцы мышей содержались отдельно, и оба пола были включены в исследование). в исследовании (1 клетка/пол, получивший Pichia/экспериментальный повтор, за исключением 1 из 3 повторов)). Это, вероятно, отчасти связано с повышенной чувствительностью самок мышей к животным моделям аллергических заболеваний.

Для нас важно отметить, что, хотя эти цифры отражают объединенные данные, три наших независимых эксперимента показали одинаковые тенденции и/или значимость результатов.Мы считаем, что повторная статистическая значимость наших результатов, несмотря на эту присущую изменчивость, говорит о надежности наблюдаемых эффектов Pichia на воспалительные исходы во время AAD. Исходные данные были предоставлены в качестве дополнения, чтобы показать это, а подписи к рисункам были обновлены для ясности. Измерение Т-клеток GATA3+ является единственным исключением из этого правила, поскольку это антитело было включено в панели проточной цитометрии только в 2 экспериментах, и поэтому изображение ответа автора 2 представляет объединенные данные из 2, а не из 3 экспериментов.

3. Что послужило причиной добавления анализа клеток IL-4+ в Приложение 1F к Рисунку 2, но не к Рисунку 2? Авторы отмечают, что ICOS связан с продукцией IL-4, но данные по IL-4 не приводятся. Кроме того, на рисунке 3-дополнение 2 включает IL-5 и IL-13, чтобы показать, что тот же ответ характерен для рисунка 2, но эти показатели не представлены на рисунке 2. Пожалуйста, либо включите данные, либо объясните.

Спасибо за возможность объяснить эти несоответствия, и мы приносим свои извинения за то, что не сделали это более ясным в методах.Антитело к ИЛ-4, используемое для проточной цитометрии, не смогло успешно окрасить наши клетки по крайней мере в 2 из 3 наших экспериментов с облучением новорожденных, поэтому эти данные не были включены. Проточный цитометр, который мы использовали для этих первоначальных экспериментов, также не вмещал дополнительные цвета, чтобы можно было добавить IL-5 и IL-13 в эти эксперименты с неонатальным воздействием. Эти дополнительные маркеры были добавлены к нашей панели в эксперименте без микробов после того, как мы модернизировали нашу машину. Чтобы решить проблему этого рецензента, мы попытались провести IHC для IL-4 в срезах легких, взятых из экспериментов, в которых мыши подвергались неонатальному воздействию P.kudriavzevii , но, к сожалению, не увенчались успехом, учитывая возраст образцов. Мы надеемся, что сможем дополнительно рассмотреть роль Т-клеток ICOS+ и продукции IL-4 в будущей работе.

4. В нескольких местах в тексте утверждается, что Pichia отсутствует в кишечнике в разные моменты времени, однако не было представлено данных, прямо подтверждающих этот вывод. Либо добавьте данные, либо удалите эти операторы.

Приносим свои извинения за нечеткое описание наших экспериментальных методов.Текст был исправлен, чтобы указать, что колонизация происходит только в период, когда щенки содержатся вместе с самками (которые получали лечение Pichia и также заселяются в период лечения), до отъема в возрасте 19 дней.

Строка 114-133: «Чтобы установить причинную роль грибкового дисбактериоза в раннем возрасте в этиологии астмы и подтвердить предыдущие результаты в когорте ECUAVIDA, мы подвергли мышей воздействию P. kudriavzevii в период новорожденности, а затем использовали клеща домашней пыли ( HDM) модель AAD для индукции воспаления дыхательных путей в возрасте шести недель (рис. 1A, B).Щенков подвергали воздействию либо P. kudriavzevii , суспендированного в фосфатно-солевом буфере (PBS), либо только PBS, окрашивая живот и морду лактирующих самок этими соответствующими растворами каждый второй день в течение двух недель после рождения».

Строка 154-166: «Подсчет колоний на 16-й (рис. 2А) и 21-й (отсутствие колоний) дней жизни показал, что, хотя уровни сильно различались, P. kudriavzevii колонизировали кишечник щенков, рожденных от самок, получавших лечение в течение двух недель. с этими дрожжами, по крайней мере, в течение двух дней после последней обработки, но они больше не присутствовали в микробиоте кишечника после того, как их отняли от груди на 19-й день жизни.Таким образом, детеныши были колонизированы только в период, когда они содержались вместе с самками и однопометниками, что указывает на то, что для поддержания колонизации требуется постоянное воздействие (рис. 2, приложение 1а)».

После отъема щенков переводят в новые клетки и содержат с однопометниками. Колонизацию в течение первых 3 недель оценивали путем подсчета колоний и путем посева образцов фекалий (когда было возможно собрать образцы фекалий) мышей на 14, 16, 18 и 21 день жизни. Эти данные были добавлены как рисунок 2-дополнение 1.Мы посеяли кишечник небольшого количества мышей на 9-й день жизни, умерщвляя этих детенышей, и путем качественного наблюдения за ростом колонии обнаружили обильную колонизацию. qPCR для Pichia на 21-й и 28-й день жизни дополнительно подтвердила едва определяемые уровни Pichia в фекальных гранулах (определяемые как Ct>30 с использованием праймеров, специфичных для P. kudriavzevii) соответственно. См. файл Excel, предоставленный рецензентам.

Количественная ПЦР

была проведена с использованием набора Qiagen Quantinova SYBR в соответствии с инструкциями производителя и следующих праймеров (3) (которые, как мы определили, специфичны для P.kudriavzevii при Кт ниже 30):

F: CTGGCCGAGCGAACTAGACT

Ч: ТТСТТТЦКТССГКТТАТТГ

~169bp продукт.

Каждая реакция содержала:

-2 мкл матричной ДНК

-Мастер-микс QuantiNova SYBR Green (Qiagen)

— Эталонный краситель Rox (Qiagen)

-h3O

— прямой праймер (10 мкМ)

-обратный праймер (10 мкм)

Реакционный объем 10 мкл

Протокол цикла был следующим:

— 95 o С в течение 2 мин

-40x: [(95 o C на 5 с) + (60 o C на 30 с)]

а.Строка 114 – данные о подсчете колоний через 21 день не показаны, удалите из текста или добавьте эту отсутствующую цифру.

Мы согласны с тем, что это важная часть наших выводов, особенно потому, что это говорит о чувствительности окна раннего периода жизни для развития иммунитета. Однако мы изо всех сил пытались правильно показать отсутствие колоний. См. добавленный рисунок 2-дополнение 1, где мы пытаемся продемонстрировать это визуально.

б. Строка 116 – нет данных, подтверждающих, что пихия исчезла после отлучения от груди.Без демонстрации того, что Pichia не сохраняется после отъема, возможно, что длительная грибковая колонизация ответственна за наблюдаемый фенотип AAD. Устраните это несоответствие, добавив соответствующие данные или адресацию в тексте.

Мы понимаем, что отсутствие подсчета колоний может быть трудно представить, поэтому мы также провели ПЦР на инокуляте, использованном в эксперименте GF, и не нашли доказательств присутствия Pichia на основе геля и количественной ПЦР (см. добавленный файл Excel).

в. Строка 120–124 — данные, подтверждающие отсутствие Pichia в кишечнике через 4 недели, отсутствуют.

См. добавленный рисунок 2-дополнение 1, где мы пытаемся продемонстрировать это визуально.

д. Строка 131-132 – не показаны окончания колонизации грибов в конкретный день.

В дополнение к дополнительным данным подсчета колоний, полученным в ходе ревизионного эксперимента, описанного в пункте 2 выше, мы выполнили секвенирование ITS-2 фекальных гранул, собранных в возрасте четырех и восьми недель в ходе наших первоначальных экспериментов, но не обнаружили последовательностей, которые были аннотированы как Pichia (или Isaatchenkia orientalis, как в базе данных UNITE называется P.Кудрявцевий). Это также теперь разъяснено в тексте:

Строка 154-166: «Подсчет колоний на 16-й (рис. 2А) и 21-й (отсутствие колоний) дней жизни показал, что, хотя уровни сильно различались, P. kudriavzevii колонизировали кишечник щенков, рожденных от самок, получавших лечение в течение двух недель. с этими дрожжами, по крайней мере, в течение двух дней после последней обработки, но они больше не присутствовали в микробиоте кишечника после того, как их отняли от груди на 19-й день жизни. Таким образом, щенки были колонизированы только в период, когда они содержались вместе с самками и однопометниками, что указывает на то, что для поддержания колонизации требуется постоянное воздействие (рис. 2, приложение 1а).

Когда мы выполнили формальный анализ секвенирования грибковой микробиоты с использованием праймеров ITS86(F) и ITS4(R) в подмножестве образцов, все результирующие файлы секвенирования имели размер <1 Мб, что указывает на то, что было обнаружено очень мало грибов (согласно стандарты, используемые Integrated Microbiome Resources, где секвенирование было проведено, секвенирование фактически не удалось). После того, как мы обработали данные секвенирования, очень немногие образцы прошли этапы качественной фильтрации, поэтому секвенирование грибов не проводилось для всех экспериментов (n = 8 из стула, собранного в возрасте 4 недель от животных, получавших лечение в неонатальном периоде (n = 4 на условие лечения) , n = 8 от мышей-подростков (6 недель; n = 4/состояние лечения, лечение в подростковом возрасте), n = 10 из стула, собранного в возрасте 8 недель (n = 2 контрольные, n = 8 Pichia; данные не полностью обработаны, учитывая, что только 3 образца имели> 150 КБ необработанных данных) в конечной точке эксперимента после модели астмы HDM).

Интересно, что мы отметили, что количество прочтений/данных, восстановленных из образцов, собранных в возрасте четырех недель, было выше, чем количество прочтений, полученных нами при анализе образцов, собранных в подростковом возрасте или в конечной точке эксперимента, даже у животных, получавших Pichia. После фильтрации качества последовательности и таксономического распределения только 2 образца для каждого условия лечения у мышей-подростков содержали > 500 прочтений грибов. Все 8 образцов от 4-недельных мышей имели не менее 500 прочтений, но грибковые сообщества существенно не различались по α- или β-разнообразию (Bray-Curtis).

928
Возраст Лечение Количество читается (после обработки)
подросток (6 недель) Control 728
подростка (6 недель) Control 379
60472 подросток (6 недель) Control 2038
подросток (6 недель) Control 304
подросток (6 недель) Pichia 552
6 недель) Pichia 466 466
подросток (6 недель) Pichia 143 143
подросток (6 недель) Pichia 873
4 недели 752
4 недели Контроль 750
4 недели Контроль ол 7485
4 недели Control 2128
4 недели Pichia 1922
4 недели Pichia 532
4 недели Pichia 842
4 недели Пичиа 1220

Образцы, взятые в возрасте 4 недель от животных, получавших неонатальное лечение:

адонис(формула=braydist_ITSpn1~Обработка, перестановки=4999) Перестановка: бесплатно

Количество перестановок: 4999

Термины добавляются последовательно (от первого к последнему)

Df SumsOfSqs MeanSqs F.Модель R2 Pr(>F)

Лечение 1 0,28239 0,28239 1,158 0,16178 0,2592

Остатки 6 1,46316 0,24386 0,83822

Всего 7 1,74555 1,00000

Глядя на идентифицированные роды грибов, большинство присутствующих грибов, вероятно, были пищевого происхождения (P1 в начале SampleID указывает на то, что эти мыши получали постнатально Pichia или носитель; следующий C указывает на контрольных животных, а P указывает на животных Pichia) :

Для обозначения этого был добавлен текст: Строка 170-174: «Отсутствие устойчивых грибковых сообществ у этих животных в возрасте четырех и восьми недель было подтверждено путем оценки присутствия грибов в ДНК, выделенной из образцов фекалий с использованием высокопроизводительного секвенирование и праймеры, нацеленные на внутреннюю транскрибируемую спейсерную область (ITS-2) гена 18S рРНК грибов (файлы секвенирования сгенерировали <1 Мб необработанных данных на образец).

5. Обсуждение данных, представленных на рис. 3C-F, коррелирует с ранее опубликованными исследованиями бактериального дисбиоза и ААД, было бы полезным дополнением. Clostidales упоминаются как непосредственный источник SCFAs. Изменилось ли количество представителей этого рода в показанном эксперименте?

Отличный вопрос, особенно интересующий нашу лабораторию. Пожалуйста, ознакомьтесь с нашим подробным ответом на пункт 9 ниже.

6. На Рисунке 3-дополнительном 1 показаны данные, подтверждающие гипотезу о том, что изменение бактериального состава в кишечнике само по себе не объясняет изменения иммунного ответа, однако не представлено никаких данных, подтверждающих, что процедура трансплантации кала успешно воспроизвела Pichia обнажил кишечный микробиом.Анализ, сравнивающий данные на рисунке 3D и дополнительном рисунке 3 1B-D, важен для того, чтобы показать, что виды бактерий, присутствующие в образце фекалий, полученном от мышей, подвергшихся воздействию Pichia, были способны успешно колонизировать стерильных мышей и быть репрезентативными для исходных Население.

Спасибо за это предложение. Этот рецензент прав в том, что колонизация стерильных мышей не всегда отражает донора. Поэтому мы были рады видеть, что все виды бактерий, кроме одного (Butyricicoccus, присутствующие в низкой численности), были перенесены на стерильных мышей после удаления низкочастотных признаков и фильтрации/разрежения данных.У стерильных мышей также наблюдалось увеличение относительной численности Akkermansia, Bifidobacterium и Allobaculum, что сопровождалось снижением относительной численности Lactobacillus по сравнению с четырехнедельными мышами SPF. Это сравнение теперь включено в дополнительный файл 2, и мы считаем, что оно подтверждает важные выводы этого эксперимента.

Также было бы интересно провести тот же анализ с образцами после AAD, чтобы показать, как мыши, подвергшиеся воздействию Pichia, и колонизированные без микробов мыши (рис. 3F и рисунок 3-дополнительный 1E-F) реагируют на модель AAD — есть ли разница?

Мы согласны с тем, что это был интересный анализ.Хотя мы считаем, что это выходит за рамки настоящего документа в формате краткого отчета, мы предоставили результаты в ответе автора, изображение 6 и ответе автора, изображение 7.

Ответ автора. Изображение 6 представляет собой относительную численность родов, идентифицированных у безмикробных животных при умерщвлении:

На изображении ответа автора 7 показаны роды, идентифицированные в образцах фекалий мышей SPF при умерщвлении:

Изменения в тексте:

1.В этом исследовании рассматривается влияние Pichia на бактериальный дисбактериоз и иммунный ответ, но не представлены данные, подтверждающие более общие изменения грибкового дисбактериоза (никакие другие виды грибов, присутствующие в кишечнике мышей, не оценивались). На протяжении всего документа, как и в строках 92-95, этот пункт не следует делать без поддержки.

Грибковый дисбиоз в данном исследовании определяется как разрастание P. kudriavzevii конкретно. Хотя это временно, мы все же считаем, что это соответствует определению изменения микробного сообщества в здоровом состоянии.См. ответ на пункт 4d. Мы также уточнили это в тексте:

Строка 110-113: «Соответственно, используя разрастание P. kudriavzevii в качестве модели грибкового дисбиоза, мы стремились определить, влияет ли грибковый дисбактериоз в неонатальном периоде на исходы астмы в более позднем возрасте, и определить, какие аспекты астматической иммунопатологии находятся под влиянием.»

2. Биологическую значимость Рисунка 2 и Рисунка 2-приложения 1 трудно интерпретировать без предварительного установления колонизации/дисбактериоза кишечного микробиома.Попробуйте сначала переместить рисунок 3, чтобы установить, что вы можете резюмировать дисбиоз, наблюдаемый у детей в этой мышиной модели, а затем показать на рисунке 2, что это коррелирует с различиями в иммунной системе в более позднем возрасте.

Спасибо за это предложение. Теперь мы добавили строку, указывающую, что щенки были колонизированы в период лечения:

.

Строка 133-135: «Присутствие P. kudriavzevii в кишечнике детенышей, рожденных от животных, получавших P. kudriavzevii в течение двухнедельного периода лечения, было подтверждено подсчетом колоний в посевах тканей толстой кишки (рис. 2 — приложение 1a). ).

Мы также добавили переходное предложение в следующий абзац:

Строка 151-154: «Чтобы дополнительно охарактеризовать грибковую колонизацию в нашей модели, мы посеяли содержимое толстой кишки или образцы кала щенков, рожденных от самок, получавших P. kudriavzevii , непосредственно до и после отъема, когда известно, что микробиота кишечника подвергается драматическим изменениям. сдвиги в составе сообщества».

3. Данные на рис. 4 не согласуются с другими данными в документе без дополнительного обсуждения связи.Расширьте обсуждение/актуальность оценки воздействия SCFAs на Pichia в этой статье. Было ли показано, что SCFAs влияют на грибковую колонизацию ранее, в анализах, которые коррелируют SCFAs со снижением AAD? Проверяется ли гипотеза о том, что перед усилением Pichia у детей произошли изменения в микробиоме, которые снизили локальные концентрации SCFAs, и это привело к избыточному росту Pichia, что, в свою очередь, еще больше повлияло на бактериальный микробиом кишечника и развитие иммунитета? Проясните связь в тексте, почему рисунок 4 важен для сюжетной линии этой статьи.Было бы полезно представить обе модели на заключительном рисунке.

Это отличный момент, и мы благодарны рецензенту за указание на это. Ясность связи между экспериментами Pichia и SCFA теперь обеспечивается прямой ссылкой на связь между низким уровнем ацетата и повышенным содержанием Pichia в образцах фекалий детей в Эквадоре. Приведенные ссылки также указывают на предыдущие примеры (особенно из группы Гэри Хаффнэгла), показывающие, что SCFAs влияют на рост грибов, связанных с AAD, после лечения антибиотиками.Ранее прямо не было показано, что SCFAs влияют на колонизацию. Обоснование исследования КЦЖК заключается в том, что кишечник новорожденных детей с риском развития астмы уникально восприимчив к транзиторной колонизации микробами, случайно встречающимися из-за бактериального дисбиоза и отсутствия КЦЖК, и что транзиторная колонизация впоследствии может изменить как местные сообщества кишечной микробиоты и нормальное развитие иммунитета. Также возможно, что грибковая колонизация является случайным событием, которое происходит в общем контексте кишечника новорожденного, где резистентность к колонизации низка, что затем ускоряет как бактериальный, так и грибковый дисбактериоз во время критического окна параллельного иммунного развития, что увеличивает риск младенца развивающаяся астма (т.е. мы не можем сказать, возникает ли сначала бактериальный или грибковый дисбиоз). Таким образом, подробный анализ/сравнение Clostridiales или SCFAs в образцах мышей, собранных после отъема, не имеет биологического смысла (мы предполагаем, что сокращение бактериальных сообществ, продуцирующих SCFAs, предшествует грибковому дисбиозу, а не вызывает эти изменения, и на рисунке 2 показаны бактериальные сообщества после грибкового дисбиоза). дисбактериоз уже возник). Мы внесли следующие изменения, чтобы внести ясность:

Строки 231-236: «Учитывая, что КЦЖК также защищают от развития астмы и их содержание в кале у младенцев с риском астмы в Эквадоре (в сочетании с грибковым дисбактериозом), в когорте ДЕТЕЙ и других когорты, мы затем определили, может ли часть защитного действия SCFAs на астму быть опосредована предотвращением колонизации кишечника младенцев грибками, связанными с астмой.

Мы также добавили дополнительные пояснения, чтобы поместить эти результаты в более широкий контекст истории:

, строки 289-294: «В совокупности наши результаты показывают, что кишечные бактериальные сообщества со сниженной способностью к выработке короткоцепочечных жирных кислот в кишечнике новорожденных с риском развития астмы допускают инвазию временных грибковых колонизаторов. Транзиторная грибковая колонизация, в свою очередь, может прямо или косвенно посредством нарушения нормальной временной последовательности сообществ микробиоты кишечника новорожденных, необходимых для надлежащего иммунного развития, дополнительно изменять иммунное развитие и восприимчивость к астме (рис. 4).

Мы надеемся, что наше исследование послужит основой для будущих исследований, направленных на дальнейшее подтверждение этой работы, включая корреляционный анализ между уровнями SCFAs и грибковой нагрузкой в ​​наборах данных о людях.

Спасибо за это предложение для дополнительной фигуры, модель, объединяющая историю, теперь включена как рисунок 4.

4. Для рисунка 3B, чтобы оценить актуальность циркулирующих Pichia-специфических IgG, сравните данные с кратностью изменений в других исследованиях в других системах.

Подобные различия в уровнях IgG были описаны другими:

Тропини и др. (2018) Клетка. (4)

Кастро-Допико и др. (2019) Иммунитет.(5)

Дорон и др. (2021) Клетка. (6)

Мы согласны с тем, что реакция малозаметна, но, учитывая, что измерение проводилось через 1 неделю после отъема, когда мыши больше не колонизированы Pichia, это не обязательно удивительно. При просмотре в формате, аналогичном другим бумагам:

Мы также провели дополнительный анализ секвенирования РНК для оценки различий маркеров воспаления/иммунного ответа на Pichia в кишечнике 16-дневных мышей.Эти данные подтверждают гипотезу о том, что колонизация в раннем возрасте P. kudriavzevii вызывает изменения в экспрессии генов, связанных с иммунитетом (особенно тех, которые связаны с функцией дендритных клеток), включая подавление химотрипсин-подобных генов (7,8), в кишки. Эти результаты были добавлены к рисунку 2-дополнение 1b.

5. Строка 84 предполагает, что данные на рисунке 1B значимы (p<0,05), но согласно рисунку это не так, отредактируйте текст, чтобы соответствующим образом подтвердить значение p.

Спасибо за указание на это, мы удалили это из текста.

Рецензент №2:

В этом отчете Бутин и его коллеги исследовали влияние воздействия P. kudriavzevii на мышей на аллергическое воспаление легких, вызванное HDM. Предпосылка работы исходит из предыдущих данных исследования CHILD, среди прочего, которые связывают определенные виды грибов с повышенной тяжестью астмы.

Спасибо, что нашли время тщательно изучить и оценить нашу работу, мы ценим ваши отзывы.

Из этой работы можно сделать два основных вывода. Во-первых, воздействие должно происходить до отъема, а во-вторых, короткоцепочечные жирные кислоты непосредственно уменьшают адгезию грибков к эпителиальным клеткам кишечника.

Рисунок 1 согласуется с предыдущими отчетами, обосновывая внимание автора к Pichia. Лучшим контролем для включения будет сравнение с другими грибами, которые могут служить отрицательным контролем. Как указывают авторы, уже имеется ряд сообщений, показывающих, что противогрибковое лечение или колонизация специфическими грибами усугубляют аллергическое воспаление на моделях мышей.Есть ли что-то уникальное в Pichia, или общий рост каких-либо грибов рассматривается как повышенная восприимчивость?

Это отличный вопрос, который постоянно интересует нас. У нас есть отдельная рукопись на рассмотрении, описывающая более широкое представление о грибковых сообществах в кишечнике детей из когорты CHILD, и поэтому мы воздержались от включения дополнительных данных по этому вопросу в настоящую работу. Основываясь на наших данных, было бы чрезмерным обобщением сказать, что это общий рост грибов, однако маловероятно, что это явление уникально для Pichia.Например, у разных групп грибов могут сохраняться определенные признаки (например, способность образовывать псевдогифы или настоящие гифы (16,17)), которые могут повышать вероятность того, что эти грибы будут связаны с исходами астмы. Мы попытались коснуться этого в нашем обсуждении (строки 269-285), но будем рады рассказать подробнее, если рецензент захочет.

Новые данные начинаются с рисунка 2, где в целом наблюдается увеличение параметров адаптивного иммунитета в группе Pichia. Вариабельность очень высока, и во многих случаях появляются «респондеры» и «нереспондеры», например.грамм. панели D, E, G, H. Может быть, это влияние клетки? Статистическая значимость достигается в большинстве случаев, вероятно, из-за объединения экспериментов для получения достаточного количества. В связи с этим непонятно, почему в одном случае объединяются данные двух экспериментов, а в другом — трех? Что является основанием для этого? В целом, несмотря на некоторые различия, особенно в анализе FACS, общее явление не выглядит особенно надежным, а параметры заболевания (в отличие от FACS) в значительной степени отсутствуют, например.грамм. продукция слизи и функция легких. Нет корреляции с уровнем колонизации Pichia на мышь и показаниями, например. у мышей с высоким уровнем эозинофилов также были более высокие КОЕ Pichia в течение 2 недель воздействия?

Это отличный момент, который вызвал много дискуссий в нашей группе. Мы также заметили, что в наших данных была значительная изменчивость, и поэтому подробно изучили это. Хотя эти цифры отражают объединенные данные, три наших независимых эксперимента показали одинаковые тенденции и/или значимость результатов.Мы считаем, что повторная статистическая значимость наших результатов, несмотря на эту присущую изменчивость, говорит о надежности наблюдаемых эффектов Pichia на воспалительные исходы во время AAD. Исходные данные были предоставлены в качестве дополнения, чтобы показать это, а подписи к рисункам были обновлены для ясности. Измерение GATA3+ Т-клеток является единственным исключением из этого правила, поскольку это антитело было включено в панели проточной цитометрии только в 2 экспериментах, и поэтому на этом рисунке представлены объединенные данные из 2, а не 3 экспериментов.

Что касается «ответивших» и «неответивших» мышей, мы заметили, что самки мышей оказались более чувствительными к воздействию грибкового дисбиоза на AAD (обратите внимание, что самки и самцы мышей содержались отдельно, и оба пола были включены в исследование). в исследовании (1 клетка/пол, получивший Pichia/экспериментальный повтор, за исключением 1 из 3 повторов)). Это, вероятно, отчасти связано с повышенной чувствительностью самок мышей к животным моделям аллергических заболеваний.

Подчеркнув еще один важный момент, хотя в идеале можно было бы провести анализ корреляции между грибковой нагрузкой и исходами астмы, мы обнаружили, что это невозможно из-за невозможности (а) получить количество фекальных колоний у новорожденных до отъема или (б) жестко регулировать сколько Pichia получил каждый щенок.Щенки колонизируются Pichia только тогда, когда они содержатся вместе с самками (которые фактически получали лечение), но теряют колонизацию, когда их отнимают от груди в возрасте 19 дней. Поэтому мы не могли точно отрегулировать, сколько Pichia получил каждый щенок. Кроме того, перед отлучением от груди щенки не производят полностью сформированные образцы фекалий, поэтому колонизация должна быть измерена как анализ конечной точки, т.е. путем сбора тканей кишечника. В результате данные о колонизации собираются у разных животных, а не у тех, которые были доставлены в конечную точку AAD.

Кроме того, мы согласны с этим рецензентом в том, что включение дополнительных данных о параметрах заболевания в AAD усилит наши выводы. Чтобы развеять опасения этого рецензента, мы попытались провести ИГХ для ИЛ-4 в срезах легкого, взятых из экспериментов, в которых мыши подвергались неонатальному воздействию P. kudriavzevii , но, к сожалению, безуспешно, учитывая возраст образцов. Однако мы смогли дополнить наши результаты, используя оценки воспаления дыхательных путей, не основанные на FACS, выполнив дополнительную гистологию для оценки образования слизи с использованием окрашивания PAS с использованием методов, аналогичных опубликованным другими (16).Эти результаты согласуются с другими нашими выводами:

Количественное количество бокаловидных клеток в первичных (A), вторичных (B) и третичных (C) дыхательных путях мышей на рисунке 1.

(D) Показывает средний индекс бокаловидных клеток для всех дыхательных путей у каждого животного. На рисунке показаны объединенные результаты трех экспериментов.

Дополнительные методы гистологии: срезы легких мышей, взятые до конечной точки в модели астмы, окрашивали периодической кислотой-Шиффом (PAS).Гистологическую оценку проводил обученный патологоанатом, который не знал о дизайне исследования и идентификаторах образцов. Из каждого слайда выбирали один первичный, один вторичный и один третичный дыхательные пути, и в каждом дыхательных путях идентифицировали сто последовательных эпителиальных клеток дыхательных путей. Количество клеток PAS+ (бокаловых клеток) на сто клеток подсчитывали и делили на общее количество эпителиальных клеток для получения индекса бокаловидных клеток для каждого дыхательных путей каждого образца. Средний индекс бокаловидных клеток на срез был получен путем усреднения индекса бокаловидных клеток трех исследованных дыхательных путей.Когда дыхательные пути не были видны на срезе, этот образец исключали из анализа. Все слайды оценивались вслепую.

Наконец, мы повторили полный 12-недельный эксперимент по воздействию в раннем возрасте и выполнили анализ клеток в смывах из бронхоальвеолярных (БАЛ) после индукции астмы. Эти результаты подтвердили наши выводы FACS.

Опасения сохраняются в отношении рис. 2-sup, где авторы изменили протокол, теперь давая Pichia перорально и после отъема.Вывод состоит в том, что это явление больше не существует, и, следовательно, воздействие должно происходить до отъема. На самом деле, в этом случае животных гораздо меньше, а легенда рисунка указывает на то, что это единственный эксперимент (никаких повторов не упоминается?). Показатель патологии, по-видимому, имеет такое же увеличение в группе Pichia, как и на рисунке 2, однако выброс в контрольной группе, вероятно, снижает значимость. Тот факт, что существует большая изменчивость и так мало мышей, а также тот факт, что использовались два разных протокола (введение через кожу или пероральный желудочный зонд), означает, что авторы не могут сделать вывод, что Pichia активна только в раннем возрасте.Эти данные не кажутся надежными, а выводы завышены.

Спасибо за отзыв, это важные моменты, и мы ценим возможность уточнить наши методы и выводы. Теперь мы понимаем, что причина включения этих результатов и сообщение, которое мы пытались изобразить с помощью этих результатов, не были четко контекстуализированы. На самом деле мы согласны с этим рецензентом по многим пунктам и поэтому включили эту цифру в качестве дополнения, а не основной цифры.Учитывая гипотезу «критического окна», согласно которой бактериальный дисбактериоз в раннем возрасте имеет решающее значение для модулирования связанных с атопией результатов в более позднем возрасте, мы провели этот эксперимент в качестве предварительной оценки того, может ли эта гипотеза быть верной и в случае грибкового дисбиоза. Мы поняли, что будет трудно точно воспроизвести методы экспериментов в раннем возрасте на старых мышах, но чувствовали, что использование метода перорального введения позволит нам более жестко регулировать количество P.kudriavzevii каждое животное получало при сохранении экспозиции пероральным путем. Учитывая, что в этом эксперименте мы получили отрицательные результаты и что эксперимент был повторен только один раз, мы уточнили наш язык, чтобы избежать завышения результатов. Все еще возможно, что, если эксперимент будет повторен, воздействие на подростков повлияет на исходы астмы, но наши данные действительно показывают, что эффект более выражен при воздействии на новорожденных. Надеемся, текст теперь отражает этот нюанс:

Строка 146-150: «Примечательно, что мыши, подвергшиеся воздействию P.kudriavzevii в течение двух недель в подростковом возрасте (в возрасте 4-6 недель) через пероральный желудочный зонд не выявили признаков усиления воспаления легких в контексте ААД, индуцированного HDM (рис. 1, приложение 1), что подчеркивает важность ранее сообщенного «критическое окно» жизни, в течение которого кишечная микробиота обладает наибольшей способностью влиять на развитие иммунитета, связанного с астмой».

На рисунке 3 отмечена высокая вариабельность воздействия Pichia, и авторы утверждают, что наблюдается увеличение специфических IgG к Pichia, однако эти данные показаны по сравнению с контролем, и наблюдается незначительный сдвиг примерно до 1.2 в большинстве образцов. Этот анализ не кажется достаточно надежным, чтобы сделать вывод об адаптивной реакции против Pichia.

Спасибо за указание на этот важный момент. Теперь мы провели дополнительный анализ секвенирования РНК в кишечнике 16-дневных мышей, чтобы оценить различия в воспалительных маркерах/иммунных реакциях на Pichia. Эти данные подтверждают гипотезу о том, что колонизация в раннем возрасте P. kudriavzevii вызывает изменения в экспрессии генов, связанных с иммунитетом (особенно тех, которые связаны с функцией дендритных клеток), включая подавление химотрипсин-подобных генов (7,8), в кишки.Эти результаты были добавлены к рисунку 2-дополнение 1b.

Мы также согласны с этим рецензентом в том, что наши данные IgG малозаметны. Однако, учитывая, что измерение проводилось через 1 неделю после отнятия от груди, когда мыши больше не колонизированы Pichia, мы считаем, что эти результаты согласуются с существующей литературой. Действительно, аналогичные различия в уровнях IgG были описаны другими авторами:

Тропини и др. (2018) Клетка. (4)

Кастро-Допико и др. (2019) Иммунитет.(5)

Дорон и др.(2021) Клетка. (6)

Наиболее четкие данные на рис. 3 получены в эксперименте по реколонизации GF, который фактически показывает, что перенос микробиома от мышей Pichia не передает какой-либо восприимчивости. Таким образом, можно сделать вывод, что эффект должен быть связан с созреванием иммунитета в раннем возрасте. Однако никаких доказательств, подтверждающих это, не приводится. Неонатальные мыши GF должны быть колонизированы в качестве контроля и измерены иммунные параметры, чтобы доказать, что имел место импринтинг в раннем возрасте.Более того, учитывая необходимость объединения нескольких экспериментов, чтобы показать их явление на рисунке 2, вероятно, потребуется одинаковое количество мышей на протяжении всей рукописи, чтобы сделать надежные выводы.

Спасибо за этот вдумчивый отзыв, этот рецензент поднимает несколько вопросов, связанных с нашими экспериментальными методами, которые вызвали бурное обсуждение в нашей группе. Наше обоснование использования безмикробных мышей в этой модели было основано на предыдущей работе с использованием стерильных мышей в качестве моделей новорожденных мышей с нормальной микробиотой, учитывая иммунологическую незрелость стерильных мышей (см. недавнюю статью: (18)).Колонизация новорожденных мышей GF с помощью нашей экспериментальной установки без передачи Pichia мышам GF была бы очень сложной задачей. Более того, было показано, что когда стерильным мышам дают только грибы, AAD фактически улучшается (19), что указывает на то, что любая бактериальная/микробная стимуляция может вызвать развитие иммунной системы у этих животных, и что присутствие бактерии необходимы, чтобы добавить биологическую значимость экспериментальной модели. Поэтому мы решили провести фекальную трансплантацию в самый ранний момент времени, когда мы могли быть уверены, что P.kudriavzevii больше не присутствовал, но можно было выявить бактериальные изменения в микробиоте. Мы включили рисунок 2-дополнение 2, чтобы показать, что сообщества бактериальной микробиоты разделяются в соответствии с условиями лечения исходных мышей-доноров, как и ожидалось.

Наконец, на рис. 4 авторы показывают, что культивирование грибов in vitro в присутствии SCFA снижает адгезию грибов к линии эпителиальных клеток кишечника. Данные ясны, но очевидное беспокойство вызывает их физиологическая значимость, а также отсутствие какой-либо связи с предыдущими данными в рукописи.В идеале авторы должны включить лучший отрицательный контроль, показывающий, что другие распространенные кишечные метаболиты не влияют на адгезию грибов. Кроме того, SCFA следует использовать в соотношениях, аналогичных наблюдаемым in vivo. На Рисунке 4 самая высокая концентрация 150 мкмоль/мл используется для каждого SCFAs, однако, если бы уровни бутирата и пропионата были соотнесены с ацетатом, вывод, вероятно, изменился бы. Следует также сообщать о прямой клеточной токсичности SCFAs. Эти данные также имели бы больший вес, если бы были проведены эксперименты in vivo для проверки того, снижается ли колонизация Pichia в раннем возрасте у мышей с более высокими уровнями SCFA.

Все это отличные моменты, и мы приносим свои извинения за то, что не нашли время в статье, чтобы четко изложить наше обоснование и подчеркнуть биологическую значимость наших методов и результатов. Чтобы решить эти проблемы, мы использовали NaCl в качестве контроля для анализа приверженности и провели дополнительный эксперимент с использованием биологически значимых концентраций SCFAs и биотина (обильный фактор, продуцируемый кишечными бактериями) в качестве дополнительного контроля. Рисунок 3K был обновлен, чтобы отразить новые результаты.При повторении этого эксперимента мы также использовали биологически значимые молярные соотношения SCFAs.

Мы хотели бы уточнить, что SCFAs больше не присутствуют в среде, когда грибковые клетки добавляются к клеткам толстой кишки (клетки Pichia центрифугируются и ресуспендируются в растворе 50/50 YPD и DMEM), поэтому токсичность не должна быть заботой. Клеточные запасы грибов, используемые для инокуляции клеток TC7, дополнительно высевали для подтверждения жизнеспособности и подтверждения того, что измерения OD отслеживаются с помощью подсчета клеток (включенных в необработанные данные для нового эксперимента).Мы также построили кривую роста и эксперименты с СЭМ, используя молярные соотношения, эквивалентные концентрациям, обнаруживаемым в кишечнике, и обнаружили, что бутират и пропионат оказывали аналогичные эффекты даже при более низких концентрациях (см. ответ автора, изображение 11; обратите внимание, что в предыдущих исследованиях использовались аналогичные концентрации 100–150 мкмоль/мл бутирата как «биологически значимые» концентрации (17,20,21)).

Первоначально мы провели анализ адгезии эпителиальных клеток в качестве проверки концепции, чтобы продемонстрировать, что снижение образования гиф имеет функциональное последствие для адгезии.Чтобы дополнительно подтвердить эти результаты, мы провели дополнительный эксперимент in vivo для оценки способности перорально доставляемых биологически значимых молярных соотношений SCFA ингибировать колонизацию кишечника мышей P. kudriavzevii. Мы заметили, что у мышей, которым добавляли коктейль SCFAs в питьевую воду, наблюдалась тенденция к уменьшению колонизации P. kudriavzevii после лечения антибиотиками и перорального введения грибков. Это было добавлено в качестве нового рисунка 3-дополнение 1.Мы не можем контролировать количество Pichia, которое получает каждый щенок, поэтому, несмотря на то, что мы пытались давать добавки SCFAs в раннем возрасте, трудно определить, как SCFAs влияют на колонизацию. По этой причине эксперименты in vivo проводились на взрослых мышах, предварительно обработанных антибиотиками.

В целом, хотя концептуально рукопись интересна, существуют серьезные опасения, связанные с надежностью наборов данных и сравнений, проведенных между различными экспериментальными системами.

Спасибо за ваш отзыв, мы надеемся, что теперь мы прояснили некоторые методы и сравнения.

(A-C) Рост во времени (вверху) и оптическая плотность (OD) при 600 нм через 18 часов (внизу)
Pichia kudriavzevii , выращенного в бульоне с дрожжевым пептоном и декстрозой (YPD) с добавлением натриевых солей короткоцепочечных жирных кислот ( SCFA) ацетат (A), бутират (B) или пропионат (C) в указанных концентрациях.

(D-G) Сканирующая электронная микроскопия P. kudriavzevii , выращенного в YPD (D) или натриевых солях ацетата (E), бутирата (F) или пропионата (G). (A-C) Данные представляют собой результаты трех независимых экспериментов, проведенных в трех повторностях. Точки представляют собой биологические повторы, а данные представлены как среднее значение ± стандартная ошибка среднего. Статистические сравнения относятся к контролям, не содержащим SCFAs. *р < 0,05, **р < 0,01, ***р < 0,001.

Рецензент №3:

Бутин и др.провели всестороннее исследование для изучения причины аллергического заболевания дыхательных путей, вызванного ранней грибковой колонизацией. Они использовали комменсальный грибок Pichia kudriavzevii в качестве разумного примера на моделях мышей. Кроме того, они демонстрируют, что заболевание индуцируется только тогда, когда мыши подвергаются воздействию в раннем возрасте, и что возникающее в результате заболевание преимущественно индуцируется грибком, а не возникающим микробиомом.

Я считаю, что это хорошо продуманное и проведенное исследование. Следующие пункты должны быть рассмотрены авторами для улучшения качества и ясности их исследования:

Спасибо за ваш положительный отзыв, мы благодарны этому рецензенту за то, что он нашел время, чтобы просмотреть нашу рукопись, и за возможность уточнить и расширить наши выводы.

Основной проблемой в рукописи являются неоправданные эксперименты с SCFAs. Неожиданно в рукописи появляется заявление о том, что в литературе сообщалось о том, что SCFA ингибируют грибки, поэтому авторы решили проверить некоторые из них на их ингибирующую роль в отношении P. kudriavzevii. Впоследствии и после успешного тестирования ингибирующей роли тестируемых SCFAs in vitro авторы заявили, что они обнаружили механизм колонизации P. kudriavzevii. Авторы могли поддержать это несколькими способами:

— Существует огромное разнообразие P.kudriavzevii 115 субъектов из детской когорты. Анализ 16S рРНК этих субъектов и корреляционный анализ с уровнями P. kudriavzevii могут доказать, что бактериальные продуценты SCFAs отрицательно коррелируют с уровнями P. kudriavzevii. Авторы смогли измерить SCFAs в образцах стула этих детей, чтобы подтвердить свою гипотезу.

Спасибо, что обратили внимание на этот важный момент. В ответ на этот отзыв мы нашли время, чтобы уточнить и более четко изложить обоснование экспериментов с SCFA и связать эти результаты с остальной частью статьи/существующей литературой.Хотя мы не измеряли непосредственно уровни SCFAs в образцах стула человека, используемых в настоящем анализе, в предыдущей публикации нашей лаборатории в журнале Science Translational Medicine (Arrieta et al., 2015) измерялись уровни SCFAs в образцах стула у подмножества детей в когорте CHILD. и обнаружили, что содержание ацетата было снижено в образцах от младенцев, у которых в более позднем возрасте развилась атопия и хрипы. Точно так же мы обнаружили, что уровни ацетата были снижены в образцах, взятых в возрасте 3 месяцев у младенцев в Эквадоре, у которых развилась атопия и хрипы в возрасте пяти лет (Arrieta et al., 2018). У этих же младенцев в тех же образцах стула также был повышен пихий. Эта информация была уточнена сейчас:

Строки 231-234: «Учитывая, что КЦЖК также защищают от развития астмы и их содержание в кале у младенцев с риском астмы в Эквадоре (в сочетании с грибковым дисбактериозом) снижается, в когорте ДЕТЕЙ и других новорожденных когорты (1,22–26)».

Мы также согласны с этим рецензентом в том, что наше исследование не определяет механизм колонизации, а скорее генерирует несколько гипотез, которые требуют проверки в будущей работе.Ясность связи между экспериментами Pichia и SCFA теперь обеспечивается прямой ссылкой на связь между низким уровнем ацетата и повышенным содержанием Pichia в образцах фекалий детей в Эквадоре. Обоснование исследования КЦЖК заключается в том, что кишечник новорожденных детей с риском развития астмы уникально восприимчив к транзиторной колонизации микробами, случайно встречающимися из-за бактериального дисбиоза и отсутствия КЦЖК, и что транзиторная колонизация впоследствии может изменить как местные сообщества кишечной микробиоты и нормальное развитие иммунитета.Также возможно, что грибковая колонизация является случайным событием, которое происходит в общем контексте кишечника новорожденного, где резистентность к колонизации низкая, что затем ускоряет как бактериальный, так и грибковый дисбиоз во время критического окна параллельного иммунного развития, что увеличивает риск младенца развивающаяся астма (т.е. мы не можем сказать, возникает ли сначала бактериальный или грибковый дисбиоз). Мы внесли следующие изменения, чтобы внести ясность:

Строки 231-236: «Учитывая, что КЦЖК также защищают от развития астмы и их содержание в кале у младенцев с риском астмы в Эквадоре (в сочетании с грибковым дисбактериозом), в когорте ДЕТЕЙ и других когорты, мы затем определили, может ли часть защитного действия SCFAs на астму быть опосредована предотвращением колонизации кишечника младенцев грибками, связанными с астмой.

Мы также добавили дополнительные пояснения, чтобы поместить эти результаты в более широкий контекст истории:

, строки 289-294: «В совокупности наши результаты показывают, что кишечные бактериальные сообщества со сниженной способностью к производству SCFAs создают условия, благоприятные для вторжения временных грибковых колонизаторов. В кишечнике новорожденного. Транзиторная грибковая колонизация, в свою очередь, может прямо или косвенно посредством нарушения нормальной временной последовательности сообществ микробиоты кишечника новорожденных, необходимых для надлежащего иммунного развития, дополнительно изменять иммунное развитие и восприимчивость к астме (рис. 4).

Мы надеемся, что наше исследование послужит основой для будущих исследований, направленных на дальнейшее подтверждение этой работы, включая корреляционный анализ между уровнями SCFAs и грибковой нагрузкой в ​​наборах данных о людях. Чтобы еще больше объединить две части нашей статьи, модель, объединяющая историю, теперь включена в виде рисунка 4.

— В экспериментах на мышах я хотел бы увидеть, что добавление в пищу этих SCFAs действительно приводит к резистентности к колонизации против P. kudriavzevii.

— В качестве альтернативы, одновременный пероральный желудочный зонд известного сильного бактериального продуцента SCFAs и P. kudriavzevii может предоставить доказательства, необходимые для поддержки гипотезы авторов.

Спасибо за это прекрасное предложение; это важный момент, который наша группа подробно обсудила в попытке определить наиболее подходящий экспериментальный подход. Мы ценим возможность более подробно остановиться на нескольких экспериментах, которые мы провели для решения этих вопросов.

Мы провели эксперимент, в котором взрослым животным, предварительно обработанным антибиотиками (для обеспечения грибковой колонизации и имитации кишечника новорожденного), давали короткоцепочечные жирные кислоты и перорально вводили через зонд P. kudriavzevii. В частности, самцов и самок мышей в возрасте от шести до семи недель помещали по два в клетку, а в питьевую воду добавляли 0,5 мг/мл цефоперазона (Σ каталог № 62893-20-3), как описано ранее (27), в дни 0-3. для очистки кишечной бактериальной микробиоты.Половина мышей дополнительно получала воду с коктейлем SCFAs в соответствии с ранее установленными протоколами (23, 28) на время эксперимента. Коктейль состоял из ацетата натрия (67,5 мМ), пропионата натрия (25,9 мМ) и бутирата натрия (40 мМ), а контрольные животные получали воду с соответствующими значениями pH и натрия (28). Всю воду стерилизовали фильтрованием и добавляли Splenda (8 г/л) для улучшения вкусовых качеств. На 3-й день всем мышам через желудочный зонд вводили 10 7 клеток P.kudriavzevii , полученный из 48-часовой культуры, созданной из одной колонии дрожжей и выращенной при 37°C при встряхивании. Через два дня после введения через желудочный зонд собирали образцы фекалий для посева. Неколонизированные мыши были исключены из анализа.

Мы наблюдали, что у мышей, которым добавляли коктейль SCFAs в питьевую воду, наблюдалась тенденция к уменьшению колонизации P. kudriavzevii после лечения антибиотиками и перорального введения грибков. Это было добавлено в качестве нового рисунка 3-дополнение 1.Мы признаем, что этот эксперимент имеет ограничения из-за различий в потреблении воды мышами и других технических проблем. Однако из-за экспериментальных ограничений, вызванных пандемией Covid-19, мы не смогли устранить неполадки в экспериментальном протоколе, но считаем, что результаты все еще подтверждают наши выводы. Мы считаем, что наш анализ адгезии эпителиальных клеток является реалистичным представлением влияния SCFAs на колонизацию грибковых клеток и достаточен для подтверждения наших утверждений.

, строки 248-257: Кроме того, у мышей, получавших коктейль SCFAs в питьевой воде, наблюдалась тенденция к уменьшению колонизации P. kudriavzevii после лечения антибиотиками и перорального введения грибков (рис. 3, приложение 1).

Кроме того, мы провели пилотное исследование, в котором мы добавили в питьевую воду самкам 4 мг/мл Splenda и 20 мМ ацетата натрия (группа вмешательства; n = 4, но одна самка, получившая P. kudriavzevii , погибла из-за обезвоживания) в соответствии с ранее описанных методов (22) или с добавлением только воды Splenda (контрольная группа; n=2), начиная с 14-го дня беременности.Воду меняли каждые два дня, пока щенков не отняли от груди в возрасте трех недель. Половина плотин в каждом состоянии очистки воды была обработана P. kudriavzevii , как описано в разделе «Методы». Затем модель AAD с использованием клещей домашней пыли (HDM) была использована для индукции астмы у щенков, когда они достигли шестинедельного возраста. У этих щенков мы наблюдали снижение тяжести ААД у животных, получавших ацетат, независимо от статуса воздействия, что затрудняет прямые выводы о способности КЦЖК защищать от ААД за счет снижения грибковой инфекции. колонизация.Эти результаты также подтвердили наше решение использовать анализ адгезии эпителиальных клеток, а не эксперименты in vivo, чтобы напрямую показать способность SCFAs влиять на способность грибковых клеток прикрепляться к эпителиальным клеткам в кишечнике.

Количество эозинофилов (слева) и процент IL-17+ (в центре) и ICOS+ (справа) Т-клеток в легких мышей, перенесших аллергическое заболевание дыхательных путей посредством сенсибилизации экстрактом клеща домашней пыли и контрольного заражения во взрослом возрасте.

Стратегии стробирования указаны на оси Y. Животные в неонатальном периоде подвергались воздействию дрожжей Pichia kudriavzevii (Pichia) или PBC (контроль) и рождались от самок, получавших либо ацетат, либо 4 мг/мл Splenda и 200 мМ ацетата натрия (ацетат), либо только Splenda (Splenda) в питьевой воде.

Один из самых интересных выводов заключался в следующем: в отличие от неонатального воздействия, мыши, подвергшиеся воздействию P.kudriavzevii в течение двух недель в подростковом возрасте (возраст 4-6 недель) через пероральный желудочный зонд не продемонстрировали усиления воспаления легких. Однако мне не совсем ясно, имеют ли две группы облучения («облучение новорожденных» и «облучение взрослых», как указано в «Методах») одни и те же методы лечения и дозировку. Пожалуйста, подробнее об этом.

Спасибо за интерес к этой находке! Мы согласны с тем, что это один из самых интересных аспектов нашего анализа, и ценим возможность уточнить его.Учитывая гипотезу «критического окна», согласно которой бактериальный дисбактериоз в раннем возрасте имеет решающее значение для модулирования связанных с атопией результатов в более позднем возрасте, мы провели этот эксперимент в качестве предварительной оценки того, может ли эта гипотеза быть верной и в случае грибкового дисбиоза. Мы поняли, что будет трудно точно воспроизвести методы экспериментов в раннем возрасте на старых мышах, но чувствовали, что использование метода перорального введения позволит нам более жестко регулировать количество P.kudriavzevii каждое животное получало при сохранении экспозиции пероральным путем. Хотя было невозможно точно отрегулировать, сколько P. kudriavzevii получал каждый щенок в неонатальных экспериментах, мы считали, что метод перорального зондового введения представляет собой улучшенный метод для экспериментов с воздействием на подростков. Мы также использовали двухнедельный период лечения, чтобы более точно воспроизвести наши неонатальные методы эксперимента. Учитывая, что в этом эксперименте мы получили отрицательные результаты и что эксперимент был повторен только один раз, мы уточнили наш язык, чтобы избежать завышения результатов.Надеемся, текст теперь отражает этот нюанс:

Строка 146-150: «Примечательно, что у мышей, подвергшихся воздействию P. kudriavzevii в течение двух недель в подростковом возрасте (возраст 4–6 недель) через пероральный желудочный зонд, не было выявлено признаков усиления воспаления легких в контексте вызванного HDM AAD. (Рисунок 1-приложение 1), подчеркивая важность ранее сообщавшегося «критического окна» жизни, в течение которого микробиота кишечника обладает наибольшей способностью влиять на развитие иммунитета, связанного с астмой».

Авторы заявили в строке 387 раздела «Методы», что «Успешный перенос бактерий толстой кишки был подтвержден с помощью секвенирования 16S», но я не нашел соответствующих результатов или цифр.

Спасибо за указание на это, теперь мы понимаем, что это не было достаточно конкретизировано в тексте, и внесли некоторые изменения, чтобы прояснить этот момент. Мы включили рисунок 2-дополнение 2, чтобы показать, что сообщества бактериальной микробиоты разделяются в соответствии с условиями лечения исходных мышей-доноров, как и ожидалось. Все виды бактерий, кроме одного (Butyricicoccus, представленные в низкой численности), перенесены на стерильных мышей после удаления низкочастотных признаков и фильтрации/редекции данных.

Строка 128: «Бактериальные популяции мышей, подвергшихся воздействию P. kudriavzevii, и мышей, не подвергавшихся воздействию P. kudriavzevii, умеренно разделены»

Укажите размер эффекта на соответствующем рисунке или в тексте, чтобы пояснить, что такое «умеренный» эффект в данном контексте.

Термин «умеренно» был удален для ясности, и в текст было добавлено значение p (p = 0,01).

Строка 131: высокая изменчивость и небольшой размер выборки для анализа 16s рРНК на мышах, на фиг. 3C, 3D, 3F (в качестве основных результатов), хотя и статистически значимые.Авторы использовали несходство Брея-Кертиса в качестве меры β-разнообразия сообщества. Мне интересно, могут ли другие меры расстояния (например, взвешенный/невзвешенный UniFrac) иметь более высокую эффективность при различении двух групп.

Спасибо за отзыв. Мы учли дисперсию, вызванную эффектами клетки (как описано в методах), поэтому значения R2 и p не так драматичны, как можно было бы ожидать, глядя на рисунок. Мы также видели, что мыши разделялись в зависимости от условий лечения в независимом эксперименте.Мы получили очень похожие результаты, используя показатели UniFrac, и в некоторых случаях размер эффекта (R2) был меньше, чем при использовании несходства Брея-Кертиса.

Строка 132: Я предлагаю добавить точки для отдельных образцов на рисунке 3E.

Выполнено для 3E и рисунка 2, приложение 2.

Строка 272: Действительно ли четырехнедельные мыши «воздействуют на взрослых», как указано в подзаголовке? или подросток?

Теперь это изменено на подростков.

Строка 383: были ли реципиентные стерильные мыши в возрасте 12-16 недель? Судя по подписи к рисунку 3, приложение 1а, индукция ААД произошла на 42-й день (6-я неделя). Пожалуйста, подтвердите и/или уточните.

Мыши-реципиенты были в возрасте 12-16 недель. День 42 относится к экспериментальной временной шкале. Теперь это поясняется в легенде рисунка:

.

(а) Экспериментальный план (цифры указывают дни экспериментальной временной шкалы, начиная с рождения мышей-доноров).

Рисунок 1: Как утверждают авторы, вариации в отношении количества грибов высоки.Если возможно, графики разброса или пчелиного роя помогут лучше оценить вариацию.

См. ответ Рецензенту 1, пункт 1.

Рисунок 2c В заголовке показана оценка патологии, обозначенная как «слева; 5–20». Однако контрольные значения явно показывают значение ниже 5. Пожалуйста, исправьте диапазон или поясните.

Спасибо, что заметили это. Это было ошибкой, так как диапазон составляет 4-20 (4 параметра оцениваются по шкале от 1 до 5). Легенды обновлены.

Рисунок 2-приложение c: То же, что и на рисунке 2C, исправьте подпись.

Это исправлено.

Рисунок 3c-d: Пожалуйста, укажите правильный размер эффекта на графике (например, F-значения или R2) или в подписи в дополнение к p-значению.

Значения R2 добавлены сюда и в рисунок 2-дополнение 2.

Рисунок 3—дополнение к рисунку c «Относительная численность первых 100 последовательностей на уровне рода […]»

«100 лучших последовательностей» не имеет смысла в этом контексте.Пожалуйста, поправьте или поясните. Я думаю, он должен быть похож на рисунок 3 — дополнение к рисунку E.

.

Спасибо. Это было изменено, чтобы указать, что он включает все идентифицированные роды в наборах данных.

Приложение к рисунку 3 «100 лучших родов»

На графике показаны только 19 родов (что разумно). Пожалуйста, сообщите об этом правильно в заголовке.

Исправлено.

Буквы подрисунков в подписях к рисункам следует набирать строчными буквами (или наоборот).

Спасибо, исправлено.

Каталожные номера:

1. Arrieta MC, Arévalo A, Stiemsma L, Dimitriu P, Chico ME, Loor S et al. Связь между грибковым и бактериальным дисбиозом у детей и атопическим хрипом у детей в неиндустриальных условиях. J Allergy Clin Immunol 2018;142:424-434.e10.

2. Douglass AP, Offei B, Braun-Galleani S, Coughlan AY, Martos AAR, Ortiz-Merino RA et al. Популяционная геномика не показывает различий между патогенными Candida krusei и Pichia kudriavzevii из окружающей среды: один вид, четыре названия.PLoS Pathog 2018;14:e1007138.

3. Карвалью А., Коста-Де-Оливейра С., Мартинс М.Л., Пина-Ваз С., Родригес А.Г., Людовико П. и соавт. Мультиплексная ПЦР-идентификация восьми клинически значимых видов Candida. Мед Микол 2007; 45: 619–627.

4. Tropini C, Moss EL, Merrill BD, Ng KM, Higginbottom SK, Casavant EP et al. Преходящее осмотическое возмущение вызывает долговременное изменение микробиоты кишечника. Ячейка 2018;173:1742-1754.e17.

5. Castro-Dopico T, Dennison TW, Ferdinand JR, Mathews RJ, Fleming A, Clift D et al.Антикомменсальный IgG вызывает воспаление кишечника и иммунитет типа 17 при язвенном колите. Иммунитет 2019;50:1099-1114.e10.

6. Дорон И., Леонарди И., Ли X В., Кусакабе Т., Пуэль А., Илиев И.Д. Микобиота кишечника человека настраивает иммунитет посредством CARD9-зависимой индукции противогрибковых антител IgG Статья Микобиота кишечника человека настраивает иммунитет посредством CARD9-зависимой индукции противогрибковых антител IgG. Впервые Cell опубликован в Интернете: 2021 г. doi: 10.1016 / j.cell.2021.01.016.

7. Naujokat C, Berges C, Höh A, Wieczorek H, Fuchs D, Ovens J et al.Активность протеасомной химотрипсиноподобной пептидазы необходима для основных функций дендритных клеток, происходящих из моноцитов человека. Иммунология 2007;120:120–132.

8. Тиба С., Икусима Х., Уэки Х., Янаи Х., Кимура Ю., Хангай С. и другие. Распознавание опухолевых клеток с помощью Dectin-1 управляет врожденными иммунными клетками для противоопухолевого ответа. eLife 2014; 3:1–20.

9. Boutin RCT., Sbihi H, Dsouza M, Malhotra R, Petersen C, Dai D et al. Изучение микробиоты кишечника младенцев для терапевтических целей против атопического заболевания.Аллергия 2020;опубликовано. дои: https://doi.org/10.1111/all.14244.

10. Arrieta MC, Stiemsma LT, Dimitriu PA, Thorson L, Russell S, Yurist-Doutsch S et al. Микробные и метаболические изменения в раннем младенчестве влияют на риск развития астмы у детей. Sci Transl Med 2015; 7:307ra152.

11. Willart MAM, Deswarte K, Pouliot P, Braun H, Beyaert R, Lambrecht BN et al. Интерлейкин-1α контролирует аллергическую сенсибилизацию к вдыхаемому клещу домашней пыли посредством эпителиального высвобождения GM-CSF и IL-33. J Exp Med 2012; 209:1505–1517.

12. Schuijs MJ, Willart MA, Vergote K, Gras D, Deswarte K, Ege MJ et al. Фермерская пыль и эндотоксин защищают от аллергии за счет индукции A20 в эпителиальных клетках легких. Наука 2015;349:1106–1110.

13. Shao TY, Ang WXG, Jiang TT, Huang FS, Andersen H, Kinder JM et al. Комменсал Candida albicans положительно калибрует системные иммунологические реакции Th27. Микроб-хозяин клетки 2019;25:404-417.e6.

14. Парк Дж., Ким М., Кан С.Г., Яннаш А.Х., Купер Б., Паттерсон Дж. и соавт.Короткоцепочечные жирные кислоты индуцируют как эффекторные, так и регуляторные Т-клетки путем подавления гистоновых деацетилаз и регуляции пути mTOR-S6K. Иммунол слизистых оболочек 2015; 8: 80–93.

15. Zhang Z, Biagini Myers JM, Brandt EB, Ryan PH, Lindsey M, Mintz-Cole RA et al. Бета-глюкан обостряет аллергическую астму независимо от грибковой сенсибилизации и способствует стероидрезистентным ответам Th3/Th27. J Allergy Clin Immunol 2017;139:54-65.e8.

16. Skalski JH, Limon JJ, Sharma P, Gargus MD, Nguyen C, Tang J et al.Экспансия комменсального грибка Wallemia mellicola в микобиоту желудочно-кишечного тракта усиливает тяжесть аллергического заболевания дыхательных путей у мышей. PLoS Pathog 2018;14:e1007260.

17. Новерр М.С., Хаффнейгл Г.Б. Регуляция морфогенеза Candida albicans метаболитами жирных кислот. Заразить 2004; 72: 6206–6210.

18. Bernardes EVT, Kucha V, Gutierrez MW, Laforest-lapointe I, Jendzjowsky NG, Cavin J et al. в сборке микробиома и иммунитете. 2020;: 1–16.

19. Jiang TT, Shao TY, Ang WXG, Kinder JM, Turner LH, Pham G et al.Комменсальные грибы повторяют защитные свойства кишечных бактерий. Микроб-хозяин клетки 2017;22:809-816.e4.

20. Schulthess J, Pandey S, Capitani M, Rue-Albrecht KC, Arnold I, Franchini F et al. Бутират жирных кислот с короткой цепью отпечатывает противомикробную программу в макрофагах. Иммунитет 2019;50:432-445.e7.

21. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly-Y M et al. Микробные метаболиты, жирные кислоты с короткой цепью, регулируют гомеостаз Treg-клеток толстой кишки.Наука 2013;341:569–573.

22. Thorburn AN, McKenzie CI, Shen S, Stanley D, Macia L, Mason LJ et al. Доказательства того, что астма является заболеванием, связанным с развитием, на которое влияет диета матери и бактериальные метаболиты. Национальная коммуна 2015;6:7320.

23. Кейт А., Хьюз М.Р., Антиньяно Ф., Кейт Дж., Димитриу П.А., Маас К.Р. и соавт. Аллергическое воспаление легких, вызванное микробиомом, облегчается короткоцепочечными жирными кислотами. Mucosal Immunol 2018;11:785–795.

24. Trompette A, Gollwitzer ES, Yadava K, Sichelstiel AK, Sprenger N, Ngom-Bru C et al.Метаболизм пищевых волокон микробиотой кишечника влияет на аллергические заболевания дыхательных путей и кроветворение. Nat Med 2014; 20: 159–166.

25. Arrieta M, Stiemsma LT, Dimitriu PA, Thorson L, Russell S, Yurist-doutsch S et al. Микробные и метаболические изменения в раннем младенчестве влияют на риск развития астмы у детей. Sci Transl Med 2015;7:ra152.

26. Roduit C, Frei R, Ferstl R, Loeliger S, Westermann P, Rhyner C et al. Высокие уровни бутирата и пропионата в раннем возрасте связаны с защитой от атопии.Allergy Eur J Allergy Clin Immunol 2019; 74: 799–809.

27. Noverr MC, Falkowski NR, Mcdonald RA, Mckenzie AN, Huffnagle GB. Развитие аллергического заболевания дыхательных путей у мышей после антибиотикотерапии и увеличение грибковой микробиоты: роль генетики хозяина, антигена и интерлейкина-13. Infect Immun 2005; 73:30–38.

28. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly-Y M et al. Микробные метаболиты, жирные кислоты с короткой цепью, регулируют гомеостаз Treg-клеток толстой кишки.Наука 2013;341:569–573.

https://doi.org/10.7554/eLife.67740.sa2 .

Добавить комментарий

Ваш адрес email не будет опубликован.